Identification of Epstein-Barr Virus and Herpes Simplex Virus Type-1 in Tonsils and Adenoids by Multiplex PCR and Tissue Culture

NB: We do not resell your papers. Upon ordering, we do an original paper exclusively for you.

NB: All your data is kept safe from the public.

Abstract:

Tonsillitis is a very widespread condition in young children. Recurrent tonsillitis has been the subject of frequent investigations. Mechanisms by which some patients develop recurring tonsillitis is still unclear. Some studies showed that tonsils and adenoids may act as a reservoir for some herpes viruses including EBV and HSV-1. The aim of this study is to verify whether tonsils and adenoids may harbor EBV, HSV-1 in latent sate and their reactivation may lead to recurrent tonsillitis, for this reason 100 samples (80 tonsils 20 adenoids) and their 100 swabs were taken to detect viral shedding in throat. Many molecular techniques are being used to demonstrate the presence of the EBV and HSV-1 such as the polymerase chain reaction (PCR) and in situ hybridization (ISH). Regarding HSV-1; all samples gave negative result (0%) using multiplex PCR for tonsils and adenoids. Tissue culture was used to isolate HSV-1 in all samples; none of them gave the characteristic cytopathogenic effect of HSV-1. Regarding EBV M-PCR of tonsils and adenoids 18 out of 100 (18%) were positive and their swabs were negative. So tonsils and adenoids harbor EBV in latent state. The prevalence of EBV infection in adenoids was higher than in tonsils, but the difference is statistically non-significant. Regarding sex, the prevalence of EBV infection is higher in males than females but the difference statistically non-significant. There was no significant difference between patients with EBV infection and patients free regarding their mean age.

Background:

Tonsils and adenoids, respectively, are very organized structures and from the immunological standpoint are the most important structures in the Waldeyer’s ring. Infection and hypertrophy are part of the immunological reaction of the palatine and pharyngeal tonsils (1).They are important in the production of antigen specific secretory immunoglobulin (IgA), a system of clefts covered by specialized epithelium allows intimate contact between antigens and immune competent cells. Antigens are transported by M cells in the specialized squamous epithelium to a tubovesicular system where they are captured by antigen presenting cells (APCs) and transported to the next layer, the extrafollicular area (2). The extrafollicular area is rich in T-cells and contains abundant vasculature allowing circulating lymphocytes to gain access to the tonsils. The lymphoid follicle is encased by the mantle zone where mature lymphocytes reside. At the core of the lymphoid follicle is the germinal center where immunoglobulin production takes place by B-cells (3). For its topography, tonsils and adenoids can be infected acutely or chronically by a number of microorganisms bacterial as well as viral (4), in some situations, these reactions can adversely affect the patients, especially when there is hypertrophy with upper respiratory airway obstruction and/or recurrent infections (5). Some studies have shown a close relationship between certain viral infection and recurrent pharyngo-tonsillitis (6, 7). In addition, it has been demonstrated that the tonsils may serve as a reservoir of some type of herpes viruses (8).

In nature, herpesviruses infect both vertebrate and non-vertebrate species. Only eight of these have been isolated routinely from humans, including herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7) and, most recently, Kaposi’s Sarcoma herpesvirus or human herpesvirus 8 (HHV-8) (9). The herpes viruses genome is large enough to code for at least 100 different proteins of more than 35 polypeptides are involved in the structure of the virus particle, some are part of the viral envelop (10). HSV-1 infections may be primary or recurrent, primary infections occur in persons without antibodies and in most individuals are clinically inapparent but results in antibody production and establishment of latent infection in sensory ganglia with the potential for subsequent viral reactivation (11). HSV-1 infects mucocutaneous sites causing both symptomatic and asymptomatic infections, and subsequent latent infection of nerve cells, symptomatic infections have diverse clinical presentation with symptoms which overlap the symptoms of other infections (12). Oropharyngeal disease More frequently in small children (1-5 years of age) and are usually asymptomatic. Symptomatic disease include fever, sore throat vesicular and ulcerative lesions, oedema, gingivostomatitis, submandibular lymphadenopathy is the most striking and common lesion. Primary infection in adults commonly causes pharyngitis and tonsillitis (13). In 1964 Epstein, Barr and Achong described herpes virus particles in cells from a common lymphoma in African children studied by Burkitt, who suspected a viral etiology of the tumor (14). The EBV DNA genome contains 172 Kbp, has G + C content of 59% and encodes about 100 genes, there are two types EBV1, EBV2 based on differences in the latency nuclear antigens genes EBNAs, EBERs (15). EBV receptors [the CD21 molecule] are expressed on mature resting B-lymphocyte, and similar receptors are present on cells of stratified squamous epithelium in the oropharynx, salivary glands and ectocervix for instance (16). Infection of oropharyngeal epithelial cells occurs initially, then infection of B-lymphocytes, which disseminate through the circulation, with the potential to enter a productive phase and release the virus elsewhere in the body. Most shedding of the virus however takes place in the oral cavity with increase shedding in immunosuppressed states (17). Primary infections in children are usually subclinical, but if they occur in young adults, acute infectious mononucleosis often develops. Autoantibodies are typical of the disease, with heterophil antibody that react with antigens on sheep erythrocyte the classic autoantibody (18). Isolation and identification of HSV has been accepted as the gold standard for the laboratory diagnosis, but in a study by (19) the use of polymerase chain reaction increased the sensitivity by 22% compared with shell vial cell culture, and results was obtained (20).

The present study was designed to find if tonsils and adenoid of patients with chronic lymphoid hyperplasia carry latent HSV-1 and EBV, also to examine their mucous samples of throat for the possible asymptomatic shedding of virus.

Patients:

This study included 100 patients with chronic tonsillitis, patient age ranged from 3 to 31 years (66 females and 84 males). Acute infection had been excluded in all the patients clinically and laboratory by: Erythrocyte Sedimentation Rate (ESR) normal range (1st hour 4-7 mm, 2nd hour 7-17 mm). Antistreptolysin 0-titre (A.S.O.T) normal levels less than 200 m/mL and C-reactive protein (CRP) normal levels less than 6 mg/L. , All patients previously were complaining from one of the following causes of tonsillectomy; recurrent attacks of acute tonsillitis, obstructive tonsillitis grade four, quinsy and complication of tonsillitis as rheumatic fever.

Samples:

80 tonsils and 20 adenoids were taken from patients soon after tonsillectomy. To evaluate the possible asymptomatic shedding of virus samples of throat mucus by throat swabs were taken from each patient before operation. Tonsillectomy and adenectomy were done in Alzahraa Hospital, Otorhino-laryngology Department, Faculty of Medicine for Girls, Al-Azhar University.

Methods of sampling:

The resected tonsils or adenoids were taken directly after operation in sterile falcon tube and transported in ice bag, they were put in sterile Petri dish and cut by sterile surgical blade into three pieces and kept at -80ºC till used.
The swabs were immediately suspended in 1 mL of Kreb’s ringer solution (Appendix), and were transported in ice bag to the lab, the tube containing swabs were shaken vigorously using vortex mixer to suspend the virus units into the media. The swabs were removed, and the media were divided into three equal volumes into sterile Eppindorf tubes and kept in -80oC until used.
All samples were kept at -80oC in virology Laboratory, Department of Microbiology, Faculty of Medicine for Girls, Al-Azhar University.

Material and Methods:

DNA Extraction from Tissue of Tonsil or Adenoid:

Extraction of DNA from tissue of tonsils and adenoids by Wizard® Genomic DNA Purification Kit Technical Manual (Promega, USA) according to the manufacturer’s instruction.

Amplification of target DNA:

the following PCR mix was added to 5 ul of extracted sample DNA: 5 ul PCR buffer, 100 umol dN TPs, 1.5 mm/l Mg CL2, Primers 0.5 umol/l(table1), Taq DNA polymerase 2.5 units and distilled water were added to reach final volume of 50 ul. Template DNA was denatured at 94oC for 2 minutes followed by 39 thermocycles each consisting of denaturation 30 seconds at 94oC, annealing 45 seconds at 60oC, extension 45 seconds at 72oC. and final elongation for 10 minutes at 72oC.The amplified DNA was analyzed by gel electrophoresis using 2.0% (w/v) agarose in a tris borate buffer containing ethidium bromide for detection of DNA.

Table (1): Showing primer types, sequences and expected PCR product size.

Primer name

Primer sequence

Expected PCR product size (bp)

HSV-GF
GTGTTCGAC TTTGCCAGCCTCTAC
HSV-1R
GACTGGCTCGCCATGCGAAAGC
223 *
EBV-R
ACTCGCACTCGGCATGCATTC
176 *
STK11-F
AGAGGACATGGCTGAGCTTCTG
STK11-R
GGCCAGACAGGCCTGGGCTGGTG
570 *

*Expected PCR product size: using HSV-GF + HSV-1R yield 223 bp, while EBV-R 176 bp and STK11-F+ STK11-R 570bp

Reference strains:

For each run of Multiplex PCR positive and negative controls were used. Positive control for HSV1-1isolate obtained from Virology Unit, Department of Microbiology Faculty of Medicine for Girls, Al-Azhar University. Positive control for EBV was EBV N95 – 8 [advanced Biotechnologist Incorporated Columbia, U.S.A.] obtained from Microbiology Department, Faculty of Veterinary medicine, Cairo University. Primers specific for exon 8 of STK11/LKB1 genomic DNA of human were used as PCR control for DNA quality and possible PCR inhibitors of the extracted DNA from the tonsils or adenoids (21).

HSV-1 Isolation in Tissue Culture:

HSV-1 was isolation in Vero culture tubes; microscopic reading for cytopathogenic effect (CPE) was performed daily for 7 days. The culture was considered positive when the characteristic HSV CPE was observed, the tubes of Vero cells with ≥ ++ of CPE were considered as the first passage of virus in specimen. Cells were removed and the cell associated virus was released by repeated freezing and thawing for 3 times and then centrifuged at 3000 rpm at 4oC for 15 minutes. Then the supernatant diluted 1/10 and amplified by another passage to confirm the activity of isolated cytopathic agents and to increase its CPE titer (22).

Statistical Analysis:

The collected data were coded, tabulated, and statistically analyzed using SPSS program (Statistical Package for Social Sciences) software version 20.

Ethical Approval:

The ethical committee of Faculty of Medicine, Al-azhar University reviewed and approved the study protocol.

Results:

Fifty patients with chronic tonsillitis (80 tonsils and 20 adenoids) were involved in this cross-sectional study done at the period from November 2018 to March 2019, collected from Al-Zahraa hospital. 44 females (43.1%) and 56 males (54.9%) their mean age was 9.2 years (S.D. = 6.2). The DNAs extracted from tonsils and adenoids were tested for PCR inhibitors and DNA quality with the internal control primers, all PCR reactions with the sample DNA and internal control primers gave the expected size of the PCR product (Figure 1). Regarding HSV-1: all Multiplex PCR done for surgically-removed tonsils and adenoids gave negative results, Tissue culture was used to isolate HSV-1 in all samples; none of them gave the characteristic cytopathogenic effect of HSV-1. Regarding EBV: 18 tonsil and adenoid samples out of 100 (18%) were positive. While none of the tested throat swabs for those positive samples gave positive result. HSV-1 not detected (0%) in both tonsils and adenoids, while that of EBV was (15%) in tonsils and (30%) in adenoids (Table & figure 2). It was found that EBV infection was higher in adenoids (30%) than tonsils (15%), but the difference is statistically non-significant, (Table & figure 3). It was found that EBV-DNA was detected in 18 (18%) of tonsils and adenoids but it was not detected in throat swabs of the positive samples (Table & figure 4). EBV infection in tonsils and adenoids was detected more in males 12/56 (21%) than females 6/44 (14%) but the difference is statistically none significant (X2= 1.22 P value=0.358). There was no significant difference between patients with EBV infection in tonsils and adenoids and patients free from EBV regarding their mean age (P Value 0.868 &0.667 Mann Whitney U test 97.5& 8).

Figure (1): Detection of EBV and HSV-1 by multiplex PCR.

Lane 1: molecular weight marker 100bp
Lane 2: Positive control for EBV 176 bp
Lane 3: Positive control for HSV-1 225 bp
Lane 4: Sample positive with internal control (570 bp) and negative for EBV and HSV-1
Lane 5: Sample positive with band of internal control and positive band for EBV in tonsil.
Lane 6: Sample positive with band of internal control and positive band for EBV in adenoid.
Lane 7: Swab sample negative for EBV.
Lane 8: Negative control (sterile water instead of DNA)

Figure &Table (2): Detection of EBV and HSV-1 in tonsils and adenoids by multiplex PCR

Lymphoid tissue

Virus
Total
HSV-1
EBV
Tonsils

12
80
%
0%
15%
100%

Adenoids

N
6
20
%
0%
30%
100%

Lymphoid tissue
EBV status
Total
Negative
Positive tonsils

N
68
12
80
%
85%
15%
100%

Adenoids

N
14
6
20
%
70%
30%
100%

Total

N
82
18
100
X2= 1.22 P value=0.358 Non-signifiant

Figure &Table (3): Detection of EBV in tonsils versus adenoids.

Figure & Table (4): Detection of EBV in tissues and throat swabs by multiplex PCR.

EBV in Swab
EBV in Tissue*
Negative
n (%)
Positive
n (%)
Total n (%)

Negative

82 (82%)
18 (18%)
100 (100%)

Positive

0 (0%)
0 (0%)
0 (0%)

Total

82(82%)
18 (18%)
100 (100%)

Discussion:

One of the most challenging issues in medicine concerns latent viral infection in particular, the specific detection of tissues that harbor these viruses, the ways viruses persist, and the mechanisms by which they are reactivated (23). Tonsils are mostly the site of initial infection, and of viral persistence and replication, it was suggested that virus infections may be involved in recurring tonsillar infections, including the Epstein-Barr virus (EBV) and herpes simplex viruses (24, 25). Furthermore, Latent infection of EBV and HSV is involved in the pathogenesis of lymphoid and epithelial neoplasm, which explain the increasing number of studies about these viruses (26). Virus reactivation would cause acute viral tonsillitis or transitory immune-suppression provoked by the virus would predispose the tonsils to bacterial infection (27). It had been approved that bovine herpes virus 1 shares multiple biologic properties with HSV-1 and can infect CD4 T cells in the tonsils and lymph nodes of bovine (28). The bovine herpes virus 1 DNA was detected in the tonsils in latently infected animals and become reactivated in states of experimentally induced immune-suppression (28). So, the present study was done to investigate the presence of HSV-1 in surgically removed tonsillar and adenoid tissue and their nasopharyngeal swabs by multiplex PCR but, none of tested samples showed positive results for HSV-1. Neither do detection of replicating HSV-1 by isolation in tissue culture. Correlating results was reported by (8) using in situ hybridization technique. But (29, 30) reported that rare cases of acute tonsillitis associated with HSV-1 were described in young patients. While, (21) using multiplex PCR found that 7.4% of his studied samples were positive for HSV-1.

EBV is one of the oncogenic viruses with a long latency period in healthy hosts and will reactivate from dormancy when the host is immune-compromised (27). Therefore identification and treatment of EBV in the tonsils are important for the prevention of malignant diseases (27), and for decreasing morbidity and mortality in immune-compromised individuals, including recipients of solid organ and bone marrow transplants (31), as well as AIDS patients (32). In this study it was found that EBV DNA was detected in (18%) tonsils and adenoids using multiplex PCR technique, this result was correlated with studies from different researchers with different molecular techniques which reported that EBV infection of the tonsils ranges from 11% to 65% suggesting that EBV has a role in recurring tonsillitis and with tonsillar malignancies in children and that the tonsils may be reservoir for the EBV (33, 5, 33, 25, 21, 26). As EBV DNA was not detected in mucous samples from EBV positive samples, so it was concluded that EBV could persist in the tonsils in a latent state ready to provoke acute infections and could act through its lymphoproliferative ability to provoke hypertrophy. Comparing the positiveness of EBV between adenoids and tonsils in the present study it was verified that adenoids are more frequently positive for EBV (30%) than tonsils (15%). Correlating results were reported by (35) who found that EBV was attracted to the adenoid tissue (57.5%) than tonsil tissue (29.4%). Many questions remain to be studies in the pathology of EBV infection and its association with the tonsils.

Conclusions and Recommendations:

Identification of a high [(30%) in adenoids and (15%) in tonsils] prevalence of EBV-DNA in recurring tonsillitis in children suggest that the tonsils may be reservoir for the EBV, and that this virus may be involved in recurring infection. Many aspects of latent and replicative EBV infection remain unclear and are possible points for future researches. Further sensitive studies such as tissue PCR technique might be necessary to show the virus localization in the cells of tonsil tissue. The M-PCR assay presented in this study can provide a rapid, sensitive, less work, and economical method for detection of some of the human herpes viruses, within a single assay and single clinical sample, thereby allowing earlier application of specific antiviral therapy and avoiding the use of redundant and potentially toxic pharmaceuticals

References:

Proenca-Modena JL, Pereira Valera FC, Jacob MG, Buzatto GP, Saturno TH, Lopes L, et al.( 2012). High rates of detection of respiratory viruses in tonsillar tissues from children with chronic adenotonsillar disease. PLoS One.;7(8):e42136 doi: 10.1371/journal.pone.0042136.
Paradise JL (1990): Efficacy of adenoidectomy for recurrent otitis media in children previously treated with typanostomy – tube placement results of parallel randomized and nonrandomized trials. JMA; 263:2066.
Richtsmeier WJ and Shikhari AM (1987): The physiology and immunology of the pharyngeal lymphoid tissue in Otolaryngology Clinics North Am, Philadelphia. WB Saunders; 20(2):129:28.
Brook I, Shah K and Jackson W (2001): Microbiology of healthy and diseased adenoids, Laryngoscope; 110:994-99.
Endo LH, Ferreira D, Montenegro MC, Pinto GA, Altemani A, Bor¬toleto AE et al (2001): Detection of Epstein-barr virus in tonsillar tissue of children and the relationship with recurrent tonsillitis. Int J Pediatr Otorhinolaryngol, 58:9-15.
Yamanaka N and Kataura A. (1984): Viral infection associated with recurrent tonsillitis, Acta Otolaryngol (Stockh); 416(Suppl.):30-37.
Hirao M, Harabuchi Y, Kataura A, Imai S and Osato T. (1996): Immunological role of human palatine tonsil in EBV persistence, Acta Otoeryngol (Stockh); Suppl. 523: 158-60.
Vassallo J, Camargo LA, Chagas CA, Pinto GA and Endo LH (2005): Search for herpesvirus 1 and 2 by in situ hybridization in tonsils and adenoids. Int J Pediatr Otorhinolaryngol; 69:345-49.
Roizman B and Pellett PE (2001): The family herpesviridae: a brief introduction. In Fields Virology, (eds) Knipe DM and Howley PM. Philadelphia, PA. Lippincott, Williams & Wilkins; vol. (2): 2381-98.
Vittone V, Diefenbach E, Triffett D, Douglas MW, Cunningham AL and Diefenbach RJ (2005): Determination of interactions between tegument proteins of herpes simplex virus type 1. J Virol; 79(15): 9566-71.
Avrin AM and Prober CG (1999): HSV in Murray PR, Baron EJ, Pfaller MA, Tenover FC and Yolken RH (eds.). Manual of clinical microbiology. 7th edition. American Society for Microbiology, Washington, D.C.P.; 878:87.
Cullen AP, Long CD and Lorincz AT (1997): Rapid detection and typing of HSV DNA in clinical specimens by hybrid capture II signal amplification probe test. Journal of Clinical Microbiology; 35:2275-78.
Simmons A (2002): Clinical manifestations and treatment considerations of herpes simplex virus infections. J. Infect. Dis; 186 (Suppl. 1): S71-S77.
Ogilvie MN (2007): Herpes viruses. In: Medical Microbiology (eds) Devid Greenwood, Richard Slack and John Peutherer. Pub. Churchill Livingstone, Sixteenth edition, Chap. 42; 399-420.
Brooks GF, Butel JS and Morse SA (2007): Herpes viruses. In: Jawetz, Melnick and Adelberg’s. Medical microbiology. Pub. Appleton and Lange, Twenty-Third edition (2004); Chap. 33; 429-51.
Cohen JI (2000): Epstein-Barr virus infection. N Engl J Med; 343:481-92.
Callan MF (2003): The evolution of antigen-specific CD8+ T cell responses after natural primary infection of humans with Epstein–Barr virus. Viral Immunol; 16: 3-16.
Leen A, Meij P, Redchenko I (2001): Differential immunogenicity of Epstein–Barr virus latent-cycle proteins for human CD4(+) T-helper 1 responses. J Virol; 75: 8649-59.
Espy MJ, Uhl JR, Mitchell PS, et al. (2000). Diagnosis of herpes simplex virus infections in the clinical laboratory by LightCycler PCR. J Clin Microbiol;38:795–799.
Gonen C, Uner A, Cetinkaya Y, et al. (2006). Tonsillar abscess formation due to herpes simplex type-1 in a severely immunocompromised stem cell transplant patient with chronic myeloid leukemia. Transpl Infect Dis;8:166–170. doi: 10.1111/j.1399-3062.2006.00131.
Sahin F,Gereeker D,Karasartora D,Murat and Ozsan,T (2007). Detection of herpes simplex virus type 1 in addition to Epstein barr virus in tonsils using a new multiplex polymenase chain reaction assay, Diagn Microbiol Infect Dis;57:47–51. doi: 10.1016/j. diagmicrobi.09.013.
World Health Organization (1991). Virus safety guidelines for diagnosis and research laboratories working.
Efstathiou S and Preston CM. (2005). Towards an understanding of the molecular basis of herpes simplex virus latency. Virus Res; 111:108-19.
Pai PC. (2004). Prevalence of LMP-1 gene in tonsils and non-neoplastic nasopharynxes by Nested-Polimerase Chain Reaction in Taiwan. Head & Neck; 619-24.
Chagas AC, Endo LH, Santos WLC, Pinto GA, Sakano E and Brousset P (2006). Is there a relationship between the detection of human herpesvirus 8 and Epstein-Barr virus in Waldeyers ring tissues. Int J Pediatr Otorhinolaryngol; 1923-27.
Dias EP, da Rocha ML, de Oliveira MOC and de Amorim LM (2009). Detection of Epstein- Barr virus in recurrent tonsillitis. Braz J Otorhinolaryngol; 75(1): 30-34.
Nadal D, Blasius M, Niggli FK, Meier G and Berger C. (2002). Epstein-Barr virus (EBV) DNA levels in palatine tonsils and autologous serum from EBV carriers. J Med Virol;67(1):54–8. doi: 10.1002/Jmv.2192.
Winkler MT, Doster A and Jones C. (2000). Persistence and reactivation of bovine herpesvirus 1 in the tonsils of latently infected calves. J Virol; 74:5337-46.
Wat PJ, Strickler JG, Myers JL and Nordstrom MR. (1994). Herpes simplex infection causing acute necrotizing tonsillitis. Mayo Clin Proc; 69:269-71.
Tanaka N (2001). Infection of herpes simplex virus (HSV) and Epstein Barr virus (EBV) in acute tonsillitis-histopathological assessment by optical and electron microscope observation of biopsy specimens of tonsils. Nippon Jibiinkoka Gakkai Kaiho; 104:1093- 1102.
Razonable RR, Brown RA, Humar A, Covington E, Alecock E and Paya CV. (2005). Herpes virus infections in solid organ transplant patient at high risk of primary cytomegatovirus disease. J infect Dis; 192:1331-39.
Duffus WA, Mermin J, Bunnell R, Byers RH, Odongo G, Ekwaru P and Downing R. (2005). Chronic herpes simplex virus types-2 infection and HIV viral Load. Int J STD AIDS; 16:733-35.
Yoda K, Aramaki H, Yamauchi YS and Kurata T (1995). Detection of herpes simplex and Epstein-Barr viruses in patient with acute tonsillitis. Abstracts III International Symposium on Tonsils. Sapporo Japan; p.3
Endo LH, Vassallo J, Sakano E and Brousset P. (2002). Detection of Epstein-Barr virus and subsets of lymphoid cells in adenoid tissue of children under 2 year of age, Int J Pediatr Otorhinolaryngol; 66:223-26.

35- Endo LH, Sakano E, Camargo LA, Ferreira DR, Pinto GA and Vassallo J. (2003). The EBV action in tonsils and adenoids, Inter cong Series; 1257:265-

Click Here To Order Now!