Category: Herpes

The prevalence of HSV –II is so high in the whole world that it leaves millions of families vulnerable to genital herpes and other diseases such as HIV. The HSV-II exposes over 400 million families worldwide to the acquisition of genital herpes and HIV diseases (Looker et al. 2). This research looks at the type 2 Herpes Simplex Virus.

HSV-II causes genital herpes. Human beings contract the genital herpes through sexual intercourse and through getting into contact with the genital surfaces or skins of an infected person. The HSV-II causes lifelong infections that have no cure. Genital herpes exhibits mild or no symptoms at all when in the initial stages of infection. At the initial stage, many people usually fail to notice that they have contracted the infection. However, when the symptoms do appear, the symptoms include genital ulcers fever, aching joints and swollen lymph nodes. The genital ulcers represent the blisters at the genital areas or around the anus of the patient.

Herpes viruses fall into three classifications. The three groups for classification of herpes viruses include herpes simplex viruses (types II and I), the alpha herpes virus and the varicella zoster viruses. All viruses contain a caspid structure made of several DNAs surrounded by a 20-faceted layer, known as icosahedral. According to Davison, herpes virus belongs to the order of Herpesvirales, the family of Herpersviridae and a subfamily of Alphaherpesvirinae(52). The herpes Simplex Virus II, as the name suggests is a virus. The medication for HSV-II entails the use of antiviral to reduce the pain it causes to patients. Examples of antiviral drugs for lowering the pain of HSV-II include acyclovir, valacyclovir and famciclovir. Currently, scientists are yet to find the vaccine and or the cure for genital herpes.

Herpes genitals become resistant to the acyclovir drugs. Jiang et al. reported that the treatment of genital herpes, caused by HSV-II virus require short-term therapy and strategies to avoid the drug developing resistance over its treatment drugs (3). According to Jiang et al, the short-term treatment plans is for patients with a strong immune system. Patients with compromised immune systems require a long-term treatment plan and are at a higher risk of developing resistance to the treatment drugs. Therefore, patients with a compromised immune system when exposed to too much acyclovir drugs would develop resistance to the drug.

The HSV-II virus comprises of a large stranded structures surrounded by a caspid cage. The caspid cage comprises of icosahedral proteins. The HSV-II virus comprise of a protein known as genome in its DNA. The HSV-II comprises of two unique sections, the long unique and short unique sections.

The life cycle of HSV-II, encompass different stages from the entry point, genetic inoculation, invasion of the immune system of human beings, the multiplication of the viruses and the latent stage. The HSV –II virus utilizes the glycoprotein on its structures, which the transmembrane receptors of the surface cells pull during the entry of HSV-II virus into the body of human beings. The glycoprotein components of the virus then combine with the cell membrane of the virus creating a hole in the surface skin of human beings where the virus enters the body of human beings. Once the HSV-II virus enters the host body, it then moves to the cell nucleus. After the virus attaches itself to the cell nucleus, it produces its DNA through its caspid portal. HSV-II caspid comprises of twelve forms of portal proteins and long unique regions, which then exits the virus DNA in a single linear arrangements (Wayengera p23). The single linear arrangements of the HSV –II virus then invade the immune system of human beings. The HSV-II virus then blocks the antigen processing system. The blocking of the antigen processing system allows the HSV-II to survive in the body of human beings for some duration.

After the HSV-II virus attacks the immune system of human beings, blocking the antigen processing cycle, the virus then multiples its production of proteins known as immediate -early. The virus uses the produced immediate-early proteins to regulate the genetic multiplication of the virus. Thereafter, the virus produces another protein, known as alpha tiff proteins, which fuse with the immediate –early proteins. The last stage of the life cycle of the HSV-II virus is the latent infection. During the latent stage of infection, the HSV-II virus interferes with the genome of human beings altering the body mechanisms of doing away with worn cells. The HSV-II viruses control human cells causing the various symptoms of genital herpes in human beings.

Works Cited

1. Davison, Andrew J. ‘Herpesvirus systematics.’ Veterinary microbiology 143.1 (2010): 52-69. (Google scholar).
2. Jiang, Yu-Chen, et al. ‘New strategies against drug resistance to herpes simplex virus.’ International journal of oral science 8.1 (2016): 1-6. (Google Scholar).
3. Looker, Katharine J., et al. ‘Global estimates of prevalent and incident herpes simplex virus type 2 infections in 2012.’ PloS one 10.1 (2015). (Google Scholar).
4. Wayengera, Misaki. ‘Identity of zinc finger nucleases with specificity to herpes simplex virus type II genomic DNA: novel HSV-2 vaccine/therapy precursors.’ Theoretical Biology and Medical Modelling 8.1 (2011): 23. (Google Scholar).

The herpes simplex virus impacts a significant portion of the worldwide population. According to the World Health Organization, 3.7 billion people younger than 50 have HSV-1 and over 417 million have HSV-2. Since it’s so common, there should be more awareness about the differences between herpes virus type 1 (HSV-1) and herpes virus type 2 (HSV-2), symptoms, and treatment. Herpes can impact various parts of the body: people experience symptoms on the anal region, external genitalia, mucosal surfaces, and skin. They appear as cold-sores, turn into blisters, and heal within a week. This is what’s known as experiencing an “outbreak”. Although there is no permanent cure for herpes, a lot of people infected with the virus will never experience physical symptoms. Here’s what you should know about HSV-1 vs HSV-2.

HSV-1 infection is the most common form of herpes. It’s highly contagious, and people usually get infected with it during their childhood. If you are diagnosed with HSV-1, you are far from alone. These are a few statistics regarding HSV-1:

• The National Institute of Health estimates that by the time they turn 50, 90 percent of adults will have been exposed to it.
• In the United States, 50% of adults have HSV-1.
• The Center for Disease Control found that the older you are, the more likely you will have the infection.

HSV-1 symptoms tend to manifest themselves on the mouth but they can also happen on other parts of the face, tongue, and skin. However, you can still get HSV-1 on your genitalia through oral sex. Part of what makes prevention tricky is that people without visible symptoms can still spread it. Here are the symptoms of HSV-1: 1) pain and itching; 2) tender, enlarged lymph nodes; 3) cold sores around the mouth; 4) painful blisters or open sores called ulcers in or around the mouth; 5) red blisters on the skin.

Oral herpes can last anywhere between 2 to 3 weeks. If you’re experiencing any of these symptoms, it’s best that you consult with a doctor to get a proper diagnosis. Despite not being that severe in people with healthy immune systems, HSV-1 can still lead to some difficulties for people who are suffering from a weakened immune system. In those cases, it can become fatal through spreading to the liver, brain, lungs and other organs. Specifically, people with atopic dermatitis — eczema — and HIV are at serious risk of this condition becoming detrimental.

Though HSV-1 is more common, HSV-2 is still significantly prevalent amongst the population. HSV-2 is generally sexually transmitted and is the cause for genital herpes. Although treatment can help lessen its severity and frequency of symptoms, there’s no cure and it’s a lifelong condition. HSV-2 is more prevalent amongst women. In the United States, amongst 14-49 year olds, 15.9% women and 8.2% men, have been infected with HSV-2. This is because it’s easier for men to give women genital herpes in penetrative sex. Here are a few more important statistics:

• In 2012, 417 million people around the world were living with the infection. Prevalence of HSV-2 infection was estimated to be highest in Africa (31.5%), and the Americas (14.4%).
• 15.5 % of people in the U.S. aged 14-49 have been infected with HSV-2.
• 10-20% of people diagnosed with HSV-2 have noticed the symptoms before they are diagnosed.

There are various symptoms of HSV-2: 1) vaginal discharge; 2) experiencing pain while urinating; 3) fever; 4) generally feeling unwell; 5) blisters and ulcers on genitals, vagina, and the cervix area.

Outbreaks last anywhere between 2-4 weeks and initial symptoms can manifest anywhere between 2-10 days after the virus enters the body. During the first year after infection, recurrent outbreaks are common. In the course of one year, someone can experience four to five outbreaks. Usually, outbreaks decrease over time as their immune system becomes used to the virus. Before an outbreak, individuals with HSV-2 may experience itching or a burning sensation in the area that was initially infected.

Both HSV-1 and HSV-2 can lead to the fatal condition of neonatal herpes, the transference of herpes from a mother to her child when giving birth. Though this is very severe, it’s quite rare and only happens in one in every 3000 births.

While there isn’t a long-term cure for herpes, there are various medical treatments that can help alleviate symptoms and shorten healing time. These treatments are all antiviral drugs, meaning they stop viruses from growing in your body. Instead of outright eliminating the virus, they just control it from spreading. These medications can also help people who don’t have symptoms reduce the chance of them passing the virus to other people.

The medications Available for Both HSV-1 and HSV-2

Acyclovir (ACV)

ACV has been used as a genital herpes medication since the late 1970s. It can be effective for chicken pox, both types of Herpes, and shingles. The medication is taken for both treatment and preventative purposes. Typically, ACV should be consumed anywhere between two to five times daily for a duration of 5 to 10 days. As a preventative measure to stop outbreaks from occurring, ACV is consumed for 12 months for two to five times daily. Here are some ACV side effects: swelling and pain in an infected area; reduced appetite; nausea; vomiting; tiredness.

Famciclovir

Famciclovir is an antiviral drug that’s prescribed for herpes infections and is primarily used for shingles and chickenpox. However, the drug can be beneficial for patients with compromised immune systems who have HSV-1 or HSV-2. Here are some Famciclovir side effects: diarrhea; headache; stomach aches and nausea; bleeding.

Valacyclovir (generic Valtrex)

Valacyclovir, popularized under the brand name Valtrex in the US, has been a leading herpes treatment since 1995. When valacyclovir is consumed, it helps mitigate the symptoms of herpes through converting into ACV and subsequently stopping the virus from spreading. Valacyclovir can cut down healing periods after an outbreak. In addition, it also reduces the likeliness of you infecting someone else with the virus. One study estimated that people who take Valacyclovir for suppressive herpes therapy are 48% less likely to give their partners herpes. Though it has similar effects to ACV, Valacyclovir stays in your body for a longer time and assists in reducing your outbreak. On top of that, a smaller dose of Valacyclovir is as effective as a larger dose of ACV. Today, valacyclovir is available online in addition to traditional medical practices. Here are some side effects of Valacyclovir: muscle pain; muscle stiffness; bleeding; cramps; sore throat; ear congestion; congestion; sneezing; losing voice.

Ultimately, it will be up to you and your physician which medication works best for your condition. Having herpes doesn’t prevent one from being generally healthy. That being said, it can still be a serious inconvenience. There are various ways in which you can prevent getting HSV-1 and HSV-2. The easiest way to prevent contracting HSV-1 and HSV-2 is being cautious and not coming into contact with cold-sores. If you do, wash your hands immediately and thoroughly. In addition, you should use condoms or latex barriers during oral and penetrative sex. Although condoms aren’t full-proof and there’s always a risk, condoms can help you not contract the virus.

For people who have herpes, there are things you can do to mitigate your chance of spreading it to other people. In addition to taking the aforementioned medications, a weakened immune system and irritation in the affected area can lead to outbreaks. Take the proper precautions, eat healthy, and get a good amount of sleep to keep your immune system in check. Studies have shown that stress leads to a weakened immune system. If you have herpes and want to prevent outbreaks, reducing your stress and anxiety can help boost your immune system and reduce your chance of having an outbreak. Here are a few things you can do to reduce your stress and anxiety: exercise; sleep; socialize; seek therapy; develop productive coping mechanisms.

Having HSV-1 or HSV-2 can have an impact on one’s self-esteem. It’s important that people who have herpes are transparent and honest with their partners about their condition. Explain to your partners that despite the stigma, this is a very common condition and it’s manageable as long as one is taking antiviral medications and not engaging in sex during outbreaks. Over time, your body’s immune system will become stronger and more resistant to both HSV-1 and HSV-2. Hence, it’s a condition that will get less severe with time. With Valtrex, you can not only prevent outbreaks but reduce the risk of spreading it to your partners.

If you suspect that you have either HSV-1 or HSV-2, it’s critical that you consult with a physician for a diagnosis. The CDC suggests that people only get tested if they are experiencing an outbreak or if they have recently have come in sexual contact with someone who has herpes. Your doctor might also give you a herpes test if you have unprotected sex with multiple people. Regardless if you have HSV-1 or HSV-2, just know that there are medications out there that can help.

Introduction

Cannabis – a word that stirs a lot of discussion and debate. But when we come to think of it, it is just an herb, a plant that has been used for medicinal, religious, and trading purposes for decades. However, despite its historical merits, it is still considered controversial. Due to its psychotropic effects, it was declared illegal in the 17th century US.

Fortunately, a series of major discoveries about the plant and its connection to the human body prevailed. In 1964, scientists from Israel were able to identify and synthesize the cannabinoid tetrahydrocannabinol (THC). Soon after, other cannabinoids were identified including cannabidiol (CBD). Another milestone achieved was in 1988 when scientists determined that the mammalian brain has receptor sites that respond pharmacologically to cannabinoids. These cannabinoid receptors comprise the endocannabinoid system (ECS), a network of specialized protein molecules embedded in cell membranes that affect various homeostatic functions.

Since those discoveries were made, more and more studies emphasizing the therapeutic effects of cannabis have been conducted. These boosted the popularity of CBD oil, a component of cannabis that does not have the same hallucinogenic and mind-altering effect as the whole plant. Today, following the legalization of some states, CBD is slowly making its way to the mainstream pharmacological world.

CBD is one among the 85 known cannabinoids in cannabis. It is often confused and mistaken for THC, cannabis’ intoxicating component that gives the feeling of being “high”. CBD, however, does not trigger the same effect. Rather, it has been proven to have numerous healing properties and it can counteract some negative effects of THC. In various studies, CBD has been identified as anti-inflammatory, anticonvulsant, anti-oxidant, anti-emetic, anti-tumorigenic, analgesic, anxiolytic and antipsychotic. These properties make it a potential medicine for the treatment of numerous diseases.

CBD acts through the endocannabinoid system of the body. It also causes direct or indirect activation of various receptor-independent channels as well as different non-cannabinoid receptors and ion channels. These networks give CBD the ability to induce a variety of effects through multiple molecular pathways. CBD’s interaction with these channels has been the subject of extensive research in the field of pharmacology.

Genital herpes

Genital herpes is a sexually transmitted disease (STD). This STD causes herpetic sores, which are painful blisters (fluid-filled bumps) that can break open and ooze fluid. About 16 percent of people between the ages of 14 and 49 have this STD.

You may feel itchy or tingly around your genitals. This is usually followed by painful, small blisters that pop and leave sores that ooze or bleed. Most people notice symptoms within a few weeks after they catch the virus from someone else. The first time it happens, you may also have a fever, headache, or other flu-like feelings. Some people have few or no symptoms.

You get herpes by having any kind of sex – vaginal, oral, or anal – with someone who is infected. It is so common in the U.S. that 1 in every 5 adults has it. Herpes can be spread during oral sex if you or your partner has a cold sore. Because the virus can not live long outside your body, you can not catch it from something like a toilet seat or towel.

Sometimes people mistake a pimple or ingrown hair for herpes. Your doctor can take a small sample from sores by using a swab test. If you don’t have symptoms but think you might have herpes, your doctor can do a blood test. It may take a few days to get your results.

Symptoms of Genital Herpes

The appearance of blisters is known as an outbreak. Your first outbreak will appear as early as two days after you contracted the virus, or as late as 30 days afterward.

1. General symptoms for males include blisters on the penis, scrotum, or buttocks (near or around the anus).
2. General symptoms for females include blisters around or near the vagina, anus, and buttocks.
3. General symptoms for both males and females include the following:

• Blisters may appear in your mouth and on your lips, face, and anywhere else that came into contact with the infected areas.
• The infected site often starts to itch, or tingle, before the actual appearance of blisters.
• The blisters may become ulcerated (open sores) and ooze fluid.
• A crust may appear over the sores within a week of the outbreak.
• Your lymph glands may become swollen. Lymph glands fight infection and inflammation in the body.
• You may have headaches, body aches, and fever.

1. General symptoms for a baby born with herpes (received through a vaginal delivery) may include ulcers on the face, body, and genitals. Babies who are born with genital herpes can develop very severe complications and experience:

• Blindness
• Brain damage
• Death

It is very important that you tell your doctor that you have genital herpes if you are pregnant. They will take precautions to prevent the virus from being transmitted to your baby during delivery, with one likely method being that your baby would be delivered via cesarean rather than routine vaginal delivery.

Causes of Genital Herpes

Two types of herpes simplex virus cause genital herpes: HSV-1 (which usually causes cold sores) and HSV-2 (which usually causes genital herpes).

The viruses get into your body through your mucous membranes. Your mucous membranes are the thin layers of tissue that line the openings of your body. They can be found in your nose, mouth, and genitals.

Once the viruses are inside your body, they incorporate themselves into your cells and then stay in the nerve cells of your pelvis. Viruses tend to multiply or adapt to their environments very easily, which makes treating them difficult.

HSV-1 or HSV-2 can be found in infected people’s bodily fluids, including:

• Saliva
• Semen
• Vaginal secretions

Diagnosing Genital Herpes

Your doctor can typically diagnose a herpes infection by a visual examination of the herpes sores. Although they are not always necessary, your doctor may confirm their diagnosis through laboratory tests.

A blood test can diagnose herpes simplex virus before you experience an outbreak. Make an appointment with your doctor if you think you have been exposed to genital herpes, even if you are not experiencing any symptoms yet.

CBD oil

Cannabidiol is a famous natural remedy used for many prevalent ailments. Better known as CBD, it is one of the 104 chemical compounds known as cannabinoids found in the cannabis or marijuana plant, Cannabis.

Tetrahydrocannabinol (THC) is the essential psychoactive cannabinoid found in cannabis and causes the sensation of getting ‘high’ that is often associated with marijuana. However, unlike THC, CBD is not psychoactive. This quality makes CBD a tempting option for those who are looking for comfort from pain and other symptoms without the mind-altering effects of marijuana or certain pharmaceutical drugs.

CBD oil is made by obtaining CBD from the cannabis plant, then mix it with a carrier oil like coconut or hemp seed oil. It is gaining acceptance in the health and wellness world, with some scientific studies proving it may help treat a variety of ailments like severe pain and anxiety.

Cannabidiol (more commonly known as CBD) has experienced an increase in popularity in recent months, in part due to its availability in high-street health shops. Previously sees as an option only for the seriously ill, CBD oil is gaining momentum among wellness fans, with its promise of being able to provide comfort from everything from pain to depression and anxiety. But what exactly is it and are there any associated side effects?

Is CBD the same as cannabis?

CBD is one of 104 chemical compounds, known as cannabinoids, that can be found in the cannabis plant. It is a naturally crop up substance, which can be extracted and diluted with a carrier oil – often hemp seed or coconut – to generate CBD oil.

Benefits and Uses of CBD Oil

A finding is revealing that CBD has a huge potential in the medical market. It eases symptoms of anxiety, diminishes pain and inflammation, helps prevent seizures, and many more. Because it’s a natural extract, there are few, if any, side effects at all. The extract works with the body’s endocannabinoid system, which is the system’s means of regulating processes, like pain, mood, appetite, and memory. CBD works with the natural system rather than being an unnatural element, so the body doesn’t try to reject it. This is why it has dominant medical benefits.

While many types of research done into the effects of CBD oil has been based on animal studies and anecdotal evidence, some much clear benefits have been highlighted.

Here are seven health benefits of CBD oil that are backed by scientific evidence.

1. Can Relieve Pain

Recently, scientists have discovered that certain parts of marijuana, including CBD, are responsible for its pain-relieving effects. The human body contains a specific system called the endocannabinoid system (ECS), which is involved in regulating a variety of functions including sleep, appetite, pain and immune system response.

The body produces endocannabinoids, which are neurotransmitters that bind to cannabinoid receptors in your nervous system.

Studies have shown that CBD may help reduce severe pain by impacting endocannabinoid receptor activity, subdue inflammation and interacting with neurotransmitters.

For instance, one study in rats found that CBD injections subdue pain response to surgical incision, while another rat study found that oral CBD treatment undoubtedly reduced sciatic nerve pain and inflammation.

Many human studies have found that a combination of CBD and THC is effective in treating pain related to multiple sclerosis and arthritis. An oral spray known as Sativex, which is a combination of THC and CBD, is approved in several countries to treat pain related to multiple sclerosis.

In a study of 47 individuals with multiple sclerosis, those treated with Sativex for one month accomplished an impressive improvement in pain, walking and muscle spasms, compared to the placebo group.

Another study found that Sativex undoubtedly improved pain during movement, pain at rest and sleep quality in 58 people with rheumatoid arthritis.

2. Could Reduce Anxiety and Depression

Anxiety and depression are prevailing mental health disorders that can have devastating impacts on health and well-being. According to the World Health Organization, depression is the single most contributors to disability worldwide, while anxiety disorders are placed sixth in position.

Anxiety and depression are often treated with pharmaceutical drugs, which can cause a number of side effects including drowsiness, agitation, insomnia, sexual dysfunction, and headache. Also, medications like benzodiazepines can be addictive and may lead to substance abuse. CBD oil has shown promise as healing for both depression and anxiety, leading many who live with these disorders to become interested in this natural approach.

In one study, 24 people with a social anxiety disorder were given either 600 mg of CBD or a placebo before a public speaking test. The group that received the CBD had automatically less anxiety, cognitive impairment, and discomfort in their speech performance, as opposed to the placebo group.

CBD oil has even been used to safely treat insomnia and anxiety in children with post-traumatic stress disorder.CBD has also shown antidepressant-like effects in many animal studies.

These qualities are associated with CBD’s ability to act on the brain’s receptors for serotonin, a neurotransmitter that regulates mood and social behavior.

3. Can Alleviate Cancer-Related Symptoms

CBD may help subdue symptoms related to cancer and side effects related to cancer treatment, like nausea, vomiting, and pain. One study looked at the impact of CBD and THC in 177 people with cancer-related pain who did not experience relief from pain medication.

Those treated with an extract containing both compounds experienced a rapid reduction in pain compared to those who received only THC extract.

CBD may also help subdue chemotherapy-induced nausea and vomiting, which are among the most common chemotherapy-related side effects for those with cancer. Though there are drugs that help with these distressing symptoms, they are most time ineffective, leading some people to look for alternatives.

A study of 16 people undergoing chemotherapy found that a one-to-one combination of CBD and THC administered via mouth spray reduced chemotherapy-related nausea and vomiting better than standard treatment alone. Some test-tube and animal studies have even shown that CBD may have anticancer properties. For instance, one test-tube study found that concentrated CBD induced cell death in human breast cancer cells.

Another finding showed that CBD inhibited the progress of aggressive breast cancer cells in mice. However, these are test-tube and animal studies, so they can only predict what might work in people. More studies in humans are necessary before conclusions can be made.

4. May Reduce Acne

Acne is a rampant skin condition that affects more than 9% of the population. It is thought to be caused by a number of factors, including genetics, bacteria, underlying inflammation and the overproduction of sebum, an oily secretion made by sebaceous glands in the skin. Findings from recent scientific studies showed CBD oil may help treat acne due to its anti-inflammatory properties and ability to reduce sebum production.

One test-tube study showed that CBD oil prevented sebaceous gland cells from secreting excessive sebum, exerted anti-inflammatory actions and stopped the activation of ‘pro-acne’ agents like inflammatory cytokines.

Another finding concluded that CBD may be an efficient and safe way to treat acne; thanks in part to its remarkable anti-inflammatory properties. Though these results are encouraging, human studies exploring the effects of CBD on acne are needed.

5. Might Have Neuroprotective Properties

Researchers believe that CBD’s ability to act on the endocannabinoid system and other brain indicating systems may provide benefits for those with neurological disorders.

One of the studies uses for CBD is in treating neurological disorders like epilepsy and multiple sclerosis. Though research in this area is still new, many studies have shown promising results. Sativex, an oral spray consisting of CBD and THC, has been proven to be a safe and effective way to subdue muscle spasticity in people with multiple sclerosis.

One study showed that Sativex reduced spasms in 75% of 276 people with multiple sclerosis who were experiencing muscle spasticity that was resistant to medications. Another study administered 214 people with severe epilepsy 0.9–2.3 grams of CBD oil per pound (2–5 g/kg) of body weight. Their seizures subdued by a median of 36.5% (27).

However, it is worthy to note that some people in both these studies experienced detrimental reactions associated with CBD treatment, such as convulsions, fever, and diarrhea. CBD has also been researched for its potential effectiveness in treating many other neurological diseases.

For example, many studies have shown that treatment with CBD improved quality of life and sleep quality for people with Parkinson’s disease.

More also, animal and test-tube studies have shown that CBD may decrease inflammation and help prevent the neurodegeneration connected with Alzheimer’s disease. In one long-term study, researchers administered CBD to mice genetically predisposed to Alzheimer’s disease, finding that it helped prevent cognitive decline.

6. Could Benefit Heart Health

Recent research has associated CBD with several benefits for the heart and circulatory system, including the ability to lower high blood pressure. High blood pressure is related to higher risks of a number of health conditions, including stroke, heart attack, and metabolic syndrome. Studies show that CBD may be a natural and effective remedy for high blood pressure.

One recent study treated 10 healthy men with one dose of 600 mg of CBD oil and found it reduced resting blood pressure, compared to a placebo. The same study also gave the men stress tests that ordinarily increase blood pressure. Interestingly, the single dose of CBD led the men to experience a smaller blood pressure progress than normal in response to these tests. Researchers have suggested that the stress- and anxiety-reducing properties of CBD are important for its ability to help lower blood pressure.

Additionally, several animal studies have shown that CBD may help reduce the inflammation and cell death related to heart disease due to its dominant antioxidant and stress-reducing properties. For example, one study found that treatment with CBD reduced oxidative stress and stopped heart damage in diabetic mice with heart disease.

7. Several Other Potential Benefits

CBD has been observed for its role in treating a number of health issues other than those mentioned above. Though more studies are needed, CBD is believed to provide the following health benefits:

Antipsychotic effects: Research shows that CBD may help people with schizophrenia and other mental disorders by reducing psychotic symptoms.

Substance abuse treatment: CBD has been shown to alter circuits in the brain related to drug addiction. In rats, CBD has been shown to reduce morphine reliance and heroin-seeking behavior.

Anti-tumor effects: In test-tube and animal studies, CBD has shown anti-tumor effects. In animals, it has been demonstrated to prevent the spread of breast, prostate, brain, colon and lung cancer.

Diabetes prevention: In diabetic mice, treatment with CBD subdued the incidence of diabetes by 56% and greatly reduced inflammation.

CBD oil genital herpes

Viruses spread by replicating their DNA into other healthy cells, which can happen so fast we call something “going viral” when it spreads quickly. Back in 1980, a study showed that 9-tetrahydrocannabinol (THC) was able to stop both types of the herpes virus from replicating and spreading. The researchers stated that THC acts as a potent antiviral against the illness, although the mechanism of action was not understood.

Similar findings were reported in a 1991 study that found that THC was able to suppress the viability of the herpes virus by 80 percent. The researcher claimed THC made the herpes virus much less “infective” and slowed its replication and spreading ability tremendously

In 2004, a study was conducted aimed at finding the mechanism responsible for the profound antiviral properties of THC. The findings revealed that the cannabinoid specifically targets the still not quite understood “viral and/or cellular mechanisms” that the herpes virus uses for replication, meaning cannabis fights herpes specifically at the cellular level.

Topical medical marijuana oils are now widely available across the United States and can be used by herpes sufferers to treat their symptoms in a safe and natural way. Because THC and the other powerful cannabinoids in cannabis are extremely fat soluble, extracting them in oil is actually one of the best ways to preserve all of their medicinal properties.

When applied to the skin topically, cannabis oils or other cannabis-oil-infused products, such as lotions, ointments, balms, salves and even sprays, are able to act transdermally, penetrating the skin and taking action at the cellular level – where the herpes virus is active. Using medical marijuana in this way is not psychoactive and will not get you “high.”

Besides the specific action of THC stopping the spread of herpes, there are more great benefits of using cannabis topically to treat herpes. Other cannabinoids like cannabidiol (CBD) present in the product have been shown to have strong pain relief and anti-inflammatory properties. This can help mitigate some of the unpleasant symptoms of herpes outbreaks in terms of both pain and ugly, raised sores while the THC fights the disease at its root.

CBD Oil Dosage Guidelines

The proper dosage all depends on your health and your body. Experiment to find out what works best for you.

Some patients effectively use tiny amounts of cannabis while others use incredibly high doses. I have seen adult patients achieve therapeutic effects at 1 mg of total cannabinoids daily, while others consume over 2000 mg daily without adverse effects.

Different Schedules of CBD Consumptions

There are three main CBD oil dosage schedules that people use to take CBD:

1. Once or Twice Per Day
2. Every 2-3 Hours
3. Hourly Microdosing

If you are dosing CBD oil, we recommend starting with one-quarter drop daily during the first week, moving up to one half a dropper during the second week, three-quarters of a dropper during the third week, and a full dropper on the fourth week.

CBD Dosage Week One Guide

If you are using a balm, it is suggested to apply a healthy amount to the area where you are experiencing soreness, dryness, or stiffness every six hours. You should experiment with different strengths of CBD balm. Start low and add more until you feel you’ve hit a sweet spot.

If you are vaping, you can keep some in your vaporizer and use it throughout the day. When starting off, try taking 3 inhales, then waiting 30 minutes to see if you notice an effect.

Gummies and capsules produce the longest effect. You can start by taking one gummy every 12 hours and then increase if you would like a more pronounced result. Like all Hempure CBD products, our gummies do not contain THC, so you do not need to worry about feeling any psychoactive effects. Capsules can be used on a similar schedule.

Abstract

Herpes Simplex Viruses is a model Herpesvirus, of which eight afflict humans. Herpes Simplex Virus enters the host cell by the sequential conformation changes and activations in gD, gH and gL, culminating with gB, the fusion protein. While there are several structures for HSV gB in post fusion conformation up until recently there has been no high-resolution structures of any Herpes Virus gB in their pre-fusion state. HCMV’s gB in pre-fusion state was recently published and was achieved by the use of tomography on a Titan Krios equipped with a Volta Phase Plate. At UoL we have also used this technique to get a higher resolution structure than the previous along with developing an automated pipeline we can then apply to other samples.

Introduction

Herpesviruses infect many vertebrate and at least one invertebrate hosts. They include over 100 viruses, of which eight cause human infections, Human Herpes Viruses 1-8 (HHV1-8). These include Herpes Simplex Viruses (HSV) 1 and 2, Varicella-zoster virus (VZV), Cytomegalovirus (CMV), Epstein-Barr virus, HHV6,7 and 8. HHV1-8 are further classified into either alpha, beta or gamma herpes viruses. Alphaherpes viruses are neurotropic and include model Herpesvirus family viruses which this paper focuses on, HSV1 and HSV2.

HSV is a model system for the Herpesvirus family and has two serotypes, HSV-1 and HSV-2, that globally infect approximately 90% of the population. HSV inflicts lifelong infections by establishing latency in the host and undergoes periodic reactivations that can spread the virus. These infections normally manifest as mucocutaneous infections including keratitis, gingivostomatitis and genital warts. While both serotypes can cause genital lesions, HSV-2 usually results in more recurrences and viral shedding than HSV-1 [1] Furthermore, infection with HSV-2 increases the risk of acquiring and transmitting HIV [2]. While most HSV infections are unpleasant, more complicated infections can occur in neonates and the immunocompromised, a growing cohort [2-4]. Infection with HSV may also extend further than current knowledge with viruses being linked to many diseases that they were not orginally thought to be associated with, such as cancers and neurological disorders, such as Alzheimer’s [5].Specific antivirals limit the impact of HSV but none cure infection. Coupled with the lack of a preventative vaccine, this virus will continue to afflict the population, making it a global health burden of high priority.

HSV has a linear DNA genome of approximately 152Kb packaged tightly in an icosahedral capsid, which is 15nm thick and 125nm in diameter and exhibits icosahedral symmetry. The complete capsid was solved in 2018 to 3.1 Å [6] using cryo-EM. The capsid itself is encased in a matrix of 20 proteins (the tegument), that lies beneath a host derived lipid envelope, decorated with 10-12 glycoproteins [7]. Therefore, the size and complexity of HSV make structural studies extremely challenging.

As with all enveloped viruses, HSV infection begins with entry, a process that requires fusion of cellular and viral membranes. While the molecular details are still not known, all events are thought to follow the fusion-through-hemifusion pathway [8].

HSV membrane fusion is mediated by four glycoproteins: the primary receptor binding protein gD, a covalently linked heterodimer gH/gL, and the fusion protein, gB. HSV fusion begins with the interaction of gD with a cellular receptor. This interaction induces a conformational change in gD, prompting gH/gL to activate gB. Successive rearrangements of gB, from its initial metastable pre-fusion conformation to the more energetically favoured post-fusion conformation, lead to membrane curvature and disruption of cellular membranes, resulting in viral capsid release into the host cell [10].

Several structures of gD exist , including unliganded gD and in complex with its receptors (reviewed in [11]) and for a partially activated form of gH/gL [12]. However, only the post-fusion structure of gB has been solved [13]. This is because all purified forms of gB adopt the post-fusion conformation, and attempts to change this have been unfruitful [14]. This leaves an important gap in the knowledge of the HSV lifecycle.

HSV-1 gB is comprised of 904 residues and is a trimer in the post-fusion conformation. Side views depict it as a three-lobed structure. The truncated post-fusion structure identifies five domains that place the two fusion loops in domain I. Both domains I and V are at the “base” of the protein, in close proximity to the viral membrane. The central domain II is postulated to mediate interactions with gH/gL and is connected to the trimeric coiled-coil, domain III( ??). Domain IV, the “crown”, resides at the top, tethered by domain III [15]. The N-terminus (residues 31-102, putatively domain VI), is not resolved in the crystal structure due to its flexibility. Amino acids 730-904, which are missing in the purified proteins used for crystallographic studies, include the cytoplasmic tail, the transmembrane domain and the membrane-proximal region, all of which are involved in virus fusion and infectivity. However, in 2018 Cooper et al. [16] were able to resolve this missing information with the aid of specialised cryo-EM grids.

Viral fusion proteins are categorized into three distinct groups, I, II and III. As a class III fusion protein, gB is composed of -helices and -sheets, and contains two fusion loops per protomer. Class III fusion proteins are found in Herpesviruses, Vesicular stomatitis virus (VSV), Human Cytomegalovirus (HCMV) and Baculovirus. The VSV fusion protein, G, is the best characterized class III fusion protein and its post-fusion form shares features similar to gB [17, 18] (Figure x). Based on the structures of pre- and post-fusion G, Gallagher et al. created an in silico model for pre-fusion gB [19, 20]. To generate it, they proposed that gB’s pre-fusion domain arrangements are similar to G in its pre-fusion conformation, and accordingly gB’s fusion loops would point toward the viral membrane. Therefore, by analogy to G, during the transition from its pre- to post-fusion conformation, the fusion loops would first relocate to the top of gB, to interact with the target membrane. Further conformational changes would position the fusion loops of gB close to the transmembrane domains, leading to the merging of the cell and virus membranes. This model is supported by an in-depth structural study using fluorescent proteins (FP) to map gB’s domains, which suggested that regions allowing insertion of the FPs are exposed [20].

A second model of pre-fusion gB was thereafter proposed by Zeev-Ben-Mordehai et al. [21]. This was generated using cryo-electron microscopy (cryo-EM) to image microvesicles expressing full-length gB. Cryo-EM allows imaging of specimens at atomic or molecular resolution in close-to-native conditions. gB expressed in microvesicles adopted two different conformations: an elongated post-fusion form, and a compact form, putatively pre-fusion gB. They then calculated a 3D average of the compact form, fitting two post-fusion domains of gB (domains I & II) into the average. Based on VSV G, and like Gallagher et al., they assumed that the domains of gB are similar in the pre- and post-fusion conformations. The resulting model suggests that gB’s fusion loops (within domain I) point away from the viral membrane. Therefore, to produce fusion, gB would extend so the fusion loops could reach the target membrane, and then conformational changes, similar to the ones proposed by Gallagher et al., would merge the cell and virus membranes.

Recently, we augmented the microvesicle strategy [21] to produce gB in its pre-fusion form [22]. Using cryo-EM, we imaged vesicles expressing full-length gB bound to monovalent antibody fragments that do not possess an Fc region (Fabs) and to whole antibodies, along with gB containing genetically encoded FP insertions. Since the Fabs, antibodies and FPs were visible by cryo-EM, we used them as landmarks to map the position of gB domains in its pre-fusion conformation. According to our experimental data, we proposed that, initially, gB [22] has the fusion loops pointing toward the viral membrane, thereby agreeing with the model proposed by Gallagher et al. Additionally, some samples trapped intermediate conformations of gB, providing insights about how the pre- to post-fusion transitions could take place. Based on these intermediate conformations, we suggested that the fusion loops of gB that initially point toward the viral membrane are relocated to the top of the molecule as a second step in the fusion process, while gB maintains a compact conformation. This intermediate conformation would therefore be similar to the one proposed by Zeev-Ben-Mordehai et al., reconciling the two models for two conformations of gB. More data will be needed to unequivocally unravel the pre-fusion structure of gB and its transition to the post fusion form, thereby elucidating the mechanism of fusion.

More recently, Zhu Si et al. [23] solved the structure of HCMV’s fusion protein, gB utilising a Volta Phase Plate (VPP) to a resolution of ~21 Å. There are several options on the market to purchase for phase plates but currently and arguably the Volta Phase Plate (VPP) solves many issues its predecessors does not. Using these new technologies and a newly developed Subtomogram averaging pipeline at UoL we have been able to attain similar resolutions for HSV’s fusion protein, gB. This structure will help with rational drug design and vaccine development to tackle HSV infection.

Material & Methods

Microvesicle Production

293T Cells were cultured in DMEM containing 10% FBS and 100 µg/ml Penicillin-streptomycin. Transfection was done in 6 well plates seeded with x X 10X/per well. All media was changed to DMEM containing 10% exosome-depleted FBS and contained no penicillin-streptomycin once seeded. Exosome-depleted FBS was created through centrifugation for an extended period of time then the use of a filter to discard exosomes. Transfection reagent was then added to the gB plasmid then onto the cells. Media on the cells was collected for processing to extract the vesicles using cushions and centrifugation. Vesicles studded with gB was then resuspended overnight.

Cryo-Electron Grid Making

Grids were made using the Lecia Plunge Freezer. Sample was mixed 1:1 with 10nm gold beads then 3ul of sample mixture was added to the grid and various blot times were using between 2-5seconds. Humidity was always set at the maximum on the machine. Samples were then plunge frozen in liquid ethane cooled by liquid nitrogen. Grids were stored in liquid nitrogen.

Cryo-Electron Tomography

DIAMOND Data 48hr session 2016 using an automated tomography session via EPU (FEI). Performed by Corey Henderson.

UoL VPP

UoL Titan Krios equipped with a Volta Phase Plate was used for an automated tomography session via EPU (FEI). 12 Tomograms were originally acquired automatically using EPU (FEI) then another x amount was collected the same way.

Tomogram Reconstruction & Subtomogram Averaging

All tomograms were reconstructed via the IMOD package in Batch mode after motion correction using Motioncorr within RELION. A bin factor of 2 was univerwsally applied to all tomograms. All volumes in the tomograms were then individually trimmed for further processing. For reference generation a small amount of pre-fusion spikes alongside post-fusion spikes were manually picked and run through PEET (IMOD).

Trimmed volumes were then separated into two discrete groups, spherical and irregular. All spherical volumes were taken forward where seedSpikes (IMOD) was performed, then sequentially spikeInit (IMOD). From here iterations in PEET (IMOD) were preformed and reference refinement was able to proceed.

Results

Manual Tomogram Reconstruction in Comparison to Automatic Tomogram Reconstruction

Low-resolution results, from a 120Kv T12 (FEI) microscope, confirmed vesicles with two types of spikes were present (FIGURE X). Landmark mapping using Fabs and FPs to increase the attainable resolution the sample and pinpoint where key domains were was also preformed (Fontana et al 2017). This provided the evidence necessary to progress to a 300Kv Titan Krios Microscope. The first tilt series acquisitions consisted of 31 tomograms. These were reconstructed first using IMOD in manual mode, then in batch mode which is the automatic version. The results were then compared and showed no significant differences and so batch tomography was confirmed in the workflow pipeline for future datasets (FIGURE X).

Volta Phase Plate Data Compared to Standard Tomography

The next dataset was taken to improve the inherently low contrast in tomography. As shown in FIGURE X, particle picking was strained due to the low resolution achieved. A small preliminary dataset was taken using the UoL Volta Phase Plate with a defocus of -0.5um. This dataset of 12 tomograms was then automatically reconstructed using Batch tomo. FIGURE X, shows tomograms automatically reconstructed with and without a VPP, (FIGUREX). Manual picking of the spikes on the tomograms gave two distinct spikes of compatible resolution to previous datasets. Using x amount of spikes two references were generated (FIGUREX) for pre and post fusion gB.

From this we were also able to fit both proposed gB models into the densities for an initial comparison.

Volta Phase Plate Collection and Automatic Picking Pipeline

With the success of the preliminary data acquisition the next stage was to compare an automatic and manual picking pipeline. Automatic picking consisted of first defining the center of the vesicles so all circular vesicles were taken forward for this approach. Their center points were defined manually in 3Dmod then spikeInit (IMOD) and sequentially seedSpikes (IMOD) was used to automatically pick the entire surface. This was then put into PEET (IMOD) for a preliminary iteration using a manually picked reference. Successive iterations and searches getting gradually more comprehensive in Theta, Psi then Phi was utlisied. From this new references were generated and used in a final search in all Euler angles. ScoreHistogram was then able to produce a graph where the minimum cross correlation (MCC) was plotted (FIGURE X). MCC Groups particles in order of how similar they are to the provided reference in PEET. Several MCC values were applied using the createAligned model function (IMOD). From this a MCC of 0.15 was found to be the most effective in first classifying out the post-fusion spikes and other automatically picked points that don’t align with the previously generated reference.

The final Outcome was a density comparable to that of the manual pipeline (FIGURE X). The two proposed models were then again fit into this density.

Hight throughput Volta Phase Plate Pipeline

The final step was to use this automatic picking pipeline on a larger dataset. 67 Tilt series were acquired and automatically reconstructed into tomograms. Of these, most had several vesicles in a single tomogram so all spherical vesicles volumes were trimmed and taken forward. Identical rounds of PEET(IMOD) iterations were preformed and generated references symmetrized (C3) to generate the final volume (FIGURE X)

Discussion

Despite using similar techniques on vesicle production, it has been clear that larger vesicles are spiked with longer, post fusion spikes in comparison to the smaller vesicles. This was noted and for data collections smaller vesicles were normally selected for tilt series acquisition. However, this is in direct contradiction to Zeev-Ben-Mordehai et al. 2016, who reported that larger vesicles typically have the shorter, pre-fusion spikes. They theorised that the longer spikes, the presumed post-fusion preferred the higher curvature of the smaller vesicles. However, speculating it could be because the vesicles produced in this study, when larger varied at a higher frequency so the vast majority were not spherical and therefore the spikes differed to that of the previous study in 2016. However, their modelling suggests that the pre-fusion form has it’s fusion loops pointing outward, away from the viral membrane which could in theory explain why it is so difficult to capture gB in its pre-fusion state and be amenable to structural analysis. It is reasonable to assume that due to the native biological membranes derived into vesicles

The recent publication of HCMVs structure has shed light on the confusion of the position of fusion loops and the overall orientation of Herpes Virus fusion proteins. When the volume of our gB structure is compared to this, it more closely resembles this Herpes Virus fusion protein (FIGURE X). This, along with the model was originally generated from in sillico modelling the post fusion structure of HSV gB into the pre-fusion volume of VSV’s G protein, would suggest that, despite lacking a high-resolution structure of HSV’s gB in the pre fusion form more closely resembles the 2014 model and the 2016 model would therefore be an intermediate. This could also be because of discrepancies in vesicle preparations making their spikes exhibit intermediate forms as we find the shorter forms are more abundant on the smaller vesicles. The 2016 paper interpretation was also referred to as controversial in a recent paper ( 2019). Class I & III fusion proteins also exhibit their fusion loops buried in all the known pre-fusion structures

This improved resolution now matches the 2019 HCMV paper and overcame our earlier issues with large defocus values to increase contrast in the low SNR of tomography leading to lower resolution as discussed in 2019 HCMV paper.

While the use of Subtomogram averaging has provided vital information for proteins that exist in more than one state such as ( S. Hover et al. 2018).

Conclusions

The pipeline of after vesicle production has been improved from low resolution tomography on a 120Kv microscope to a 300Kv microscope equipped with an energy filter and Volta Phase Plate to optimize tilt series acquisition. From this we have been able to implement a higher throughput tomogram reconstruction and sequentially a Subtomogram averaging pipeline that rivals a manual pipeline. This has enabled higher resolution of the elusive HSV gB protein in its pre-fusion form which corresponds with a recently published paper for the equivalent protein in HCMV. Recently another dataset of gB100 (fontana et al) has been acquired using the Titan Krios equipped again with a Volta Phase Plate, energy filter and camera, reconstructed automatically using batch Tomo (IMOD). This will now be put through the automatic pipeline for Subtomogram averaging to map the antibody in greater detail, building on the 2017(?) Fontana et al. paper. Along with this all non-spherical vesicle tomograms already reconstructed will be taken forward with the use of MeshInit (IMOD) to increase particle numbers.

Background Information Not for Main Text

Cryo-Electron Microscopy

Cryo-electron microscopy (cryo-EM) is a powerful structural technique that has recently undergone a ‘resolution revolution’. Whole cells to macromolecules are amenable to cryo-EM. Cryo-EM employs the vitrifying of specimens via rapid freezing. This allows the imaging of specimens at high resolution in close-to-native conditions, thus rivalling x-ray crystallography. Near-atomic resolution de novo model-building is also possible and currently the highest resolution structure is at 1.8A [24].

FEI’s Titan Krios is the world leader in electron microscopes, featuring an ultra-stable Schottky Field emission gun (FEG), flexible high-tension (80kV-300kV), robotic loading (maximum 12 grids), automatic column cooling, automatic and fast data collection among many other cutting edge features [reviewed in [25]. Major limitations to cryo-electron microscopy, which hinder the ability to reach resolutions as high as x-ray crystallography include the signal-to-noise ratio (SNR), charging and sample movement due to exposure to the electron-beam. However, this is largely compensated for with the introduction of Direct Electron Detectors (DEDs).

Cryo-Electron Tomography

Cryo-Electron Tomography (ET) allows the generation of 3D images, such as single particle analysis (SPA). Tomography involves acquiring a tilt series of projection images which is subsequently aligned, computationally, to create a 3D image, a tomogram. Tilting of the specimen is achieved by rotating the stage the specimen is mounted on inside the microscope. Tilting is limited to a range of approximately ±60°, which, results in a “missing wedge” of information in Fourier space. Acquisition of tilt schemes involves a multitude of steps, including, but not limited to, focusing, tracking, alignments and image capture. This process is automated via the use of software packages such as EPU (E Pluribus Unum) & SerialEM. Typically, cryo-ET is sufficient to produce molecular resolution. However, the low SNR of cryo-ET may also be lessened with Subtomogram averaging whereby homogeneous features of a heterogeneous sample may be extracted and averaged.

1. Corey L., W.A.H.K., Sparling PF, Stamm WE, et al., Genital herpes, Sexually transmitted diseases. 2008: New York, McGraw Hill. p. 399-438.
2. WHO. Herpes Simplex Virus. 2017 [cited 2017 17/01]; Available from: http://www.who.int/mediacentre/factsheets/fs400/en/.
3. Dupuis, S., et al., Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat Genet, 2003. 33(3): p. 388-91.
4. Kimberlin, D.W., Herpes simplex virus infections in neonates and early childhood. Semin Pediatr Infect Dis, 2005. 16(4): p. 271-81.
5. Wozniak, M.A. and R.F. Itzhaki, Antiviral agents in Alzheimer’s disease: hope for the future? Ther Adv Neurol Disord, 2010. 3(3): p. 141-52.
6. Yuan, S., et al., Cryo-EM structure of a herpesvirus capsid at 3.1 Å. Science, 2018. 360(6384): p. eaao7283.
7. Grunewald, K., et al., Three-dimensional structure of herpes simplex virus from cryo-electron tomography. Science, 2003. 302(5649): p. 1396-8.
8. Chernomordik, L.V. and M.M. Kozlov, Mechanics of membrane fusion. Nat Struct Mol Biol, 2008. 15(7): p. 675-83.
9. Harrison, S.C., Viral membrane fusion. Nat Struct Mol Biol, 2008. 15(7): p. 690-8.
10. Eisenberg, R.J., et al., Herpes virus fusion and entry: a story with many characters. Viruses, 2012. 4(5): p. 800-32.
11. Krummenacher, C., et al., Entry of herpesviruses into cells: the enigma variations. Adv Exp Med Biol, 2013. 790: p. 178-95.
12. Chowdary, T.K., et al., Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL. Nat Struct Mol Biol, 2010. 17(7): p. 882-8.
13. Stampfer, S.D., et al., Structural basis of local, pH-dependent conformational changes in glycoprotein B from herpes simplex virus type 1. J Virol, 2010. 84(24): p. 12924-33.
14. Vitu, E., et al., Extensive mutagenesis of the HSV-1 gB ectodomain reveals remarkable stability of its postfusion form. J Mol Biol, 2013. 425(11): p. 2056-71.
15. Cooper, R.S. and E.E. Heldwein, Herpesvirus gB: A Finely Tuned Fusion Machine. Viruses, 2015. 7(12): p. 6552-69.
16. Cooper, R.S., et al., Structural basis for membrane anchoring and fusion regulation of the herpes simplex virus fusogen gB. Nature structural & molecular biology, 2018. 25(5): p. 416-424.
17. Roche, S., et al., Structures of vesicular stomatitis virus glycoprotein: membrane fusion revisited. Cell Mol Life Sci, 2008. 65(11): p. 1716-28.
18. Roche, S., et al., Structure of the prefusion form of the vesicular stomatitis virus glycoprotein G. Science, 2007. 315(5813): p. 843-8.
19. Atanasiu, D., et al., Dual split protein-based fusion assay reveals that mutations to herpes simplex virus (HSV) glycoprotein gB alter the kinetics of cell-cell fusion induced by HSV entry glycoproteins. J Virol, 2013. 87(21): p. 11332-45.
20. Gallagher, J.R., et al., Functional fluorescent protein insertions in herpes simplex virus gB report on gB conformation before and after execution of membrane fusion. PLoS Pathog, 2014. 10(9): p. e1004373.
21. Zeev-Ben-Mordehai, T., et al., Two distinct trimeric conformations of natively membrane-anchored full-length herpes simplex virus 1 glycoprotein B. Proc Natl Acad Sci U S A, 2016. 113(15): p. 4176-81.
22. Fontana, J., et al., The Fusion Loops of the Initial Prefusion Conformation of Herpes Simplex Virus 1 Fusion Protein Point Toward the Membrane. MBio, 2017. 8(4).
23. Si, Z., et al., Different functional states of fusion protein gB revealed on human cytomegalovirus by cryo electron tomography with Volta phase plate. PLOS Pathogens, 2018. 14(12): p. e1007452.
24. Merk, A., et al., Breaking Cryo-EM Resolution Barriers to Facilitate Drug Discovery. Cell, 2016. 165(7): p. 1698-1707.
25. Elmlund, D., S.N. Le, and H. Elmlund, High-resolution cryo-EM: the nuts and bolts. Curr Opin Struct Biol, 2017. 46: p. 1-6.

Abstract:

Tonsillitis is a very widespread condition in young children. Recurrent tonsillitis has been the subject of frequent investigations. Mechanisms by which some patients develop recurring tonsillitis is still unclear. Some studies showed that tonsils and adenoids may act as a reservoir for some herpes viruses including EBV and HSV-1. The aim of this study is to verify whether tonsils and adenoids may harbor EBV, HSV-1 in latent sate and their reactivation may lead to recurrent tonsillitis, for this reason 100 samples (80 tonsils 20 adenoids) and their 100 swabs were taken to detect viral shedding in throat. Many molecular techniques are being used to demonstrate the presence of the EBV and HSV-1 such as the polymerase chain reaction (PCR) and in situ hybridization (ISH). Regarding HSV-1; all samples gave negative result (0%) using multiplex PCR for tonsils and adenoids. Tissue culture was used to isolate HSV-1 in all samples; none of them gave the characteristic cytopathogenic effect of HSV-1. Regarding EBV M-PCR of tonsils and adenoids 18 out of 100 (18%) were positive and their swabs were negative. So tonsils and adenoids harbor EBV in latent state. The prevalence of EBV infection in adenoids was higher than in tonsils, but the difference is statistically non-significant. Regarding sex, the prevalence of EBV infection is higher in males than females but the difference statistically non-significant. There was no significant difference between patients with EBV infection and patients free regarding their mean age.

Background:

Tonsils and adenoids, respectively, are very organized structures and from the immunological standpoint are the most important structures in the Waldeyer’s ring. Infection and hypertrophy are part of the immunological reaction of the palatine and pharyngeal tonsils (1).They are important in the production of antigen specific secretory immunoglobulin (IgA), a system of clefts covered by specialized epithelium allows intimate contact between antigens and immune competent cells. Antigens are transported by M cells in the specialized squamous epithelium to a tubovesicular system where they are captured by antigen presenting cells (APCs) and transported to the next layer, the extrafollicular area (2). The extrafollicular area is rich in T-cells and contains abundant vasculature allowing circulating lymphocytes to gain access to the tonsils. The lymphoid follicle is encased by the mantle zone where mature lymphocytes reside. At the core of the lymphoid follicle is the germinal center where immunoglobulin production takes place by B-cells (3). For its topography, tonsils and adenoids can be infected acutely or chronically by a number of microorganisms bacterial as well as viral (4), in some situations, these reactions can adversely affect the patients, especially when there is hypertrophy with upper respiratory airway obstruction and/or recurrent infections (5). Some studies have shown a close relationship between certain viral infection and recurrent pharyngo-tonsillitis (6, 7). In addition, it has been demonstrated that the tonsils may serve as a reservoir of some type of herpes viruses (8).

In nature, herpesviruses infect both vertebrate and non-vertebrate species. Only eight of these have been isolated routinely from humans, including herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7) and, most recently, Kaposi’s Sarcoma herpesvirus or human herpesvirus 8 (HHV-8) (9). The herpes viruses genome is large enough to code for at least 100 different proteins of more than 35 polypeptides are involved in the structure of the virus particle, some are part of the viral envelop (10). HSV-1 infections may be primary or recurrent, primary infections occur in persons without antibodies and in most individuals are clinically inapparent but results in antibody production and establishment of latent infection in sensory ganglia with the potential for subsequent viral reactivation (11). HSV-1 infects mucocutaneous sites causing both symptomatic and asymptomatic infections, and subsequent latent infection of nerve cells, symptomatic infections have diverse clinical presentation with symptoms which overlap the symptoms of other infections (12). Oropharyngeal disease More frequently in small children (1-5 years of age) and are usually asymptomatic. Symptomatic disease include fever, sore throat vesicular and ulcerative lesions, oedema, gingivostomatitis, submandibular lymphadenopathy is the most striking and common lesion. Primary infection in adults commonly causes pharyngitis and tonsillitis (13). In 1964 Epstein, Barr and Achong described herpes virus particles in cells from a common lymphoma in African children studied by Burkitt, who suspected a viral etiology of the tumor (14). The EBV DNA genome contains 172 Kbp, has G + C content of 59% and encodes about 100 genes, there are two types EBV1, EBV2 based on differences in the latency nuclear antigens genes EBNAs, EBERs (15). EBV receptors [the CD21 molecule] are expressed on mature resting B-lymphocyte, and similar receptors are present on cells of stratified squamous epithelium in the oropharynx, salivary glands and ectocervix for instance (16). Infection of oropharyngeal epithelial cells occurs initially, then infection of B-lymphocytes, which disseminate through the circulation, with the potential to enter a productive phase and release the virus elsewhere in the body. Most shedding of the virus however takes place in the oral cavity with increase shedding in immunosuppressed states (17). Primary infections in children are usually subclinical, but if they occur in young adults, acute infectious mononucleosis often develops. Autoantibodies are typical of the disease, with heterophil antibody that react with antigens on sheep erythrocyte the classic autoantibody (18). Isolation and identification of HSV has been accepted as the gold standard for the laboratory diagnosis, but in a study by (19) the use of polymerase chain reaction increased the sensitivity by 22% compared with shell vial cell culture, and results was obtained (20).

The present study was designed to find if tonsils and adenoid of patients with chronic lymphoid hyperplasia carry latent HSV-1 and EBV, also to examine their mucous samples of throat for the possible asymptomatic shedding of virus.

Patients:

This study included 100 patients with chronic tonsillitis, patient age ranged from 3 to 31 years (66 females and 84 males). Acute infection had been excluded in all the patients clinically and laboratory by: Erythrocyte Sedimentation Rate (ESR) normal range (1st hour 4-7 mm, 2nd hour 7-17 mm). Antistreptolysin 0-titre (A.S.O.T) normal levels less than 200 m/mL and C-reactive protein (CRP) normal levels less than 6 mg/L. , All patients previously were complaining from one of the following causes of tonsillectomy; recurrent attacks of acute tonsillitis, obstructive tonsillitis grade four, quinsy and complication of tonsillitis as rheumatic fever.

Samples:

80 tonsils and 20 adenoids were taken from patients soon after tonsillectomy. To evaluate the possible asymptomatic shedding of virus samples of throat mucus by throat swabs were taken from each patient before operation. Tonsillectomy and adenectomy were done in Alzahraa Hospital, Otorhino-laryngology Department, Faculty of Medicine for Girls, Al-Azhar University.

Methods of sampling:

1. The resected tonsils or adenoids were taken directly after operation in sterile falcon tube and transported in ice bag, they were put in sterile Petri dish and cut by sterile surgical blade into three pieces and kept at -80ºC till used.
2. The swabs were immediately suspended in 1 mL of Kreb’s ringer solution (Appendix), and were transported in ice bag to the lab, the tube containing swabs were shaken vigorously using vortex mixer to suspend the virus units into the media. The swabs were removed, and the media were divided into three equal volumes into sterile Eppindorf tubes and kept in -80oC until used.
3. All samples were kept at -80oC in virology Laboratory, Department of Microbiology, Faculty of Medicine for Girls, Al-Azhar University.

Material and Methods:

DNA Extraction from Tissue of Tonsil or Adenoid:

Extraction of DNA from tissue of tonsils and adenoids by Wizard® Genomic DNA Purification Kit Technical Manual (Promega, USA) according to the manufacturer’s instruction.

Amplification of target DNA:

the following PCR mix was added to 5 ul of extracted sample DNA: 5 ul PCR buffer, 100 umol dN TPs, 1.5 mm/l Mg CL2, Primers 0.5 umol/l(table1), Taq DNA polymerase 2.5 units and distilled water were added to reach final volume of 50 ul. Template DNA was denatured at 94oC for 2 minutes followed by 39 thermocycles each consisting of denaturation 30 seconds at 94oC, annealing 45 seconds at 60oC, extension 45 seconds at 72oC. and final elongation for 10 minutes at 72oC.The amplified DNA was analyzed by gel electrophoresis using 2.0% (w/v) agarose in a tris borate buffer containing ethidium bromide for detection of DNA.

Table (1): Showing primer types, sequences and expected PCR product size.

Primer name

Primer sequence

Expected PCR product size (bp)

1. HSV-GF
2. GTGTTCGAC TTTGCCAGCCTCTAC
3. HSV-1R
4. GACTGGCTCGCCATGCGAAAGC
5. 223 *
6. EBV-R
7. ACTCGCACTCGGCATGCATTC
8. 176 *
9. STK11-F
10. AGAGGACATGGCTGAGCTTCTG
11. STK11-R
12. GGCCAGACAGGCCTGGGCTGGTG
13. 570 *

*Expected PCR product size: using HSV-GF + HSV-1R yield 223 bp, while EBV-R 176 bp and STK11-F+ STK11-R 570bp

Reference strains:

For each run of Multiplex PCR positive and negative controls were used. Positive control for HSV1-1isolate obtained from Virology Unit, Department of Microbiology Faculty of Medicine for Girls, Al-Azhar University. Positive control for EBV was EBV N95 – 8 [advanced Biotechnologist Incorporated Columbia, U.S.A.] obtained from Microbiology Department, Faculty of Veterinary medicine, Cairo University. Primers specific for exon 8 of STK11/LKB1 genomic DNA of human were used as PCR control for DNA quality and possible PCR inhibitors of the extracted DNA from the tonsils or adenoids (21).

HSV-1 Isolation in Tissue Culture:

HSV-1 was isolation in Vero culture tubes; microscopic reading for cytopathogenic effect (CPE) was performed daily for 7 days. The culture was considered positive when the characteristic HSV CPE was observed, the tubes of Vero cells with ≥ ++ of CPE were considered as the first passage of virus in specimen. Cells were removed and the cell associated virus was released by repeated freezing and thawing for 3 times and then centrifuged at 3000 rpm at 4oC for 15 minutes. Then the supernatant diluted 1/10 and amplified by another passage to confirm the activity of isolated cytopathic agents and to increase its CPE titer (22).

Statistical Analysis:

The collected data were coded, tabulated, and statistically analyzed using SPSS program (Statistical Package for Social Sciences) software version 20.

Ethical Approval:

The ethical committee of Faculty of Medicine, Al-azhar University reviewed and approved the study protocol.

Results:

Fifty patients with chronic tonsillitis (80 tonsils and 20 adenoids) were involved in this cross-sectional study done at the period from November 2018 to March 2019, collected from Al-Zahraa hospital. 44 females (43.1%) and 56 males (54.9%) their mean age was 9.2 years (S.D. = 6.2). The DNAs extracted from tonsils and adenoids were tested for PCR inhibitors and DNA quality with the internal control primers, all PCR reactions with the sample DNA and internal control primers gave the expected size of the PCR product (Figure 1). Regarding HSV-1: all Multiplex PCR done for surgically-removed tonsils and adenoids gave negative results, Tissue culture was used to isolate HSV-1 in all samples; none of them gave the characteristic cytopathogenic effect of HSV-1. Regarding EBV: 18 tonsil and adenoid samples out of 100 (18%) were positive. While none of the tested throat swabs for those positive samples gave positive result. HSV-1 not detected (0%) in both tonsils and adenoids, while that of EBV was (15%) in tonsils and (30%) in adenoids (Table & figure 2). It was found that EBV infection was higher in adenoids (30%) than tonsils (15%), but the difference is statistically non-significant, (Table & figure 3). It was found that EBV-DNA was detected in 18 (18%) of tonsils and adenoids but it was not detected in throat swabs of the positive samples (Table & figure 4). EBV infection in tonsils and adenoids was detected more in males 12/56 (21%) than females 6/44 (14%) but the difference is statistically none significant (X2= 1.22 P value=0.358). There was no significant difference between patients with EBV infection in tonsils and adenoids and patients free from EBV regarding their mean age (P Value 0.868 &0.667 Mann Whitney U test 97.5& 8).

Figure (1): Detection of EBV and HSV-1 by multiplex PCR.

1. Lane 1: molecular weight marker 100bp
2. Lane 2: Positive control for EBV 176 bp
3. Lane 3: Positive control for HSV-1 225 bp
4. Lane 4: Sample positive with internal control (570 bp) and negative for EBV and HSV-1
5. Lane 5: Sample positive with band of internal control and positive band for EBV in tonsil.
6. Lane 6: Sample positive with band of internal control and positive band for EBV in adenoid.
7. Lane 7: Swab sample negative for EBV.
8. Lane 8: Negative control (sterile water instead of DNA)

Figure &Table (2): Detection of EBV and HSV-1 in tonsils and adenoids by multiplex PCR

Lymphoid tissue

1. Virus
2. Total
3. HSV-1
4. EBV
5. Tonsils

N

• 12
• 80
• %
• 0%
• 15%
• 100%

1. Adenoids

• N
• 6
• 20
• %
• 0%
• 30%
• 100%

1. Lymphoid tissue
2. EBV status
3. Total
4. Negative
5. Positive tonsils

• N
• 68
• 12
• 80
• %
• 85%
• 15%
• 100%

1. Adenoids

• N
• 14
• 6
• 20
• %
• 70%
• 30%
• 100%

1. Total

• N
• 82
• 18
• 100
• X2= 1.22 P value=0.358 Non-signifiant

Figure &Table (3): Detection of EBV in tonsils versus adenoids.

Figure & Table (4): Detection of EBV in tissues and throat swabs by multiplex PCR.

• EBV in Swab
• EBV in Tissue*
• Negative
• n (%)
• Positive
• n (%)
• Total n (%)

1. Negative

• 82 (82%)
• 18 (18%)
• 100 (100%)

1. Positive

• 0 (0%)
• 0 (0%)
• 0 (0%)

1. Total

• 82(82%)
• 18 (18%)
• 100 (100%)

Discussion:

One of the most challenging issues in medicine concerns latent viral infection in particular, the specific detection of tissues that harbor these viruses, the ways viruses persist, and the mechanisms by which they are reactivated (23). Tonsils are mostly the site of initial infection, and of viral persistence and replication, it was suggested that virus infections may be involved in recurring tonsillar infections, including the Epstein-Barr virus (EBV) and herpes simplex viruses (24, 25). Furthermore, Latent infection of EBV and HSV is involved in the pathogenesis of lymphoid and epithelial neoplasm, which explain the increasing number of studies about these viruses (26). Virus reactivation would cause acute viral tonsillitis or transitory immune-suppression provoked by the virus would predispose the tonsils to bacterial infection (27). It had been approved that bovine herpes virus 1 shares multiple biologic properties with HSV-1 and can infect CD4 T cells in the tonsils and lymph nodes of bovine (28). The bovine herpes virus 1 DNA was detected in the tonsils in latently infected animals and become reactivated in states of experimentally induced immune-suppression (28). So, the present study was done to investigate the presence of HSV-1 in surgically removed tonsillar and adenoid tissue and their nasopharyngeal swabs by multiplex PCR but, none of tested samples showed positive results for HSV-1. Neither do detection of replicating HSV-1 by isolation in tissue culture. Correlating results was reported by (8) using in situ hybridization technique. But (29, 30) reported that rare cases of acute tonsillitis associated with HSV-1 were described in young patients. While, (21) using multiplex PCR found that 7.4% of his studied samples were positive for HSV-1.

EBV is one of the oncogenic viruses with a long latency period in healthy hosts and will reactivate from dormancy when the host is immune-compromised (27). Therefore identification and treatment of EBV in the tonsils are important for the prevention of malignant diseases (27), and for decreasing morbidity and mortality in immune-compromised individuals, including recipients of solid organ and bone marrow transplants (31), as well as AIDS patients (32). In this study it was found that EBV DNA was detected in (18%) tonsils and adenoids using multiplex PCR technique, this result was correlated with studies from different researchers with different molecular techniques which reported that EBV infection of the tonsils ranges from 11% to 65% suggesting that EBV has a role in recurring tonsillitis and with tonsillar malignancies in children and that the tonsils may be reservoir for the EBV (33, 5, 33, 25, 21, 26). As EBV DNA was not detected in mucous samples from EBV positive samples, so it was concluded that EBV could persist in the tonsils in a latent state ready to provoke acute infections and could act through its lymphoproliferative ability to provoke hypertrophy. Comparing the positiveness of EBV between adenoids and tonsils in the present study it was verified that adenoids are more frequently positive for EBV (30%) than tonsils (15%). Correlating results were reported by (35) who found that EBV was attracted to the adenoid tissue (57.5%) than tonsil tissue (29.4%). Many questions remain to be studies in the pathology of EBV infection and its association with the tonsils.

Conclusions and Recommendations:

Identification of a high [(30%) in adenoids and (15%) in tonsils] prevalence of EBV-DNA in recurring tonsillitis in children suggest that the tonsils may be reservoir for the EBV, and that this virus may be involved in recurring infection. Many aspects of latent and replicative EBV infection remain unclear and are possible points for future researches. Further sensitive studies such as tissue PCR technique might be necessary to show the virus localization in the cells of tonsil tissue. The M-PCR assay presented in this study can provide a rapid, sensitive, less work, and economical method for detection of some of the human herpes viruses, within a single assay and single clinical sample, thereby allowing earlier application of specific antiviral therapy and avoiding the use of redundant and potentially toxic pharmaceuticals

References:

1. Proenca-Modena JL, Pereira Valera FC, Jacob MG, Buzatto GP, Saturno TH, Lopes L, et al.( 2012). High rates of detection of respiratory viruses in tonsillar tissues from children with chronic adenotonsillar disease. PLoS One.;7(8):e42136 doi: 10.1371/journal.pone.0042136.
2. Paradise JL (1990): Efficacy of adenoidectomy for recurrent otitis media in children previously treated with typanostomy – tube placement results of parallel randomized and nonrandomized trials. JMA; 263:2066.
3. Richtsmeier WJ and Shikhari AM (1987): The physiology and immunology of the pharyngeal lymphoid tissue in Otolaryngology Clinics North Am, Philadelphia. WB Saunders; 20(2):129:28.
4. Brook I, Shah K and Jackson W (2001): Microbiology of healthy and diseased adenoids, Laryngoscope; 110:994-99.
5. Endo LH, Ferreira D, Montenegro MC, Pinto GA, Altemani A, Bor¬toleto AE et al (2001): Detection of Epstein-barr virus in tonsillar tissue of children and the relationship with recurrent tonsillitis. Int J Pediatr Otorhinolaryngol, 58:9-15.
6. Yamanaka N and Kataura A. (1984): Viral infection associated with recurrent tonsillitis, Acta Otolaryngol (Stockh); 416(Suppl.):30-37.
7. Hirao M, Harabuchi Y, Kataura A, Imai S and Osato T. (1996): Immunological role of human palatine tonsil in EBV persistence, Acta Otoeryngol (Stockh); Suppl. 523: 158-60.
8. Vassallo J, Camargo LA, Chagas CA, Pinto GA and Endo LH (2005): Search for herpesvirus 1 and 2 by in situ hybridization in tonsils and adenoids. Int J Pediatr Otorhinolaryngol; 69:345-49.
9. Roizman B and Pellett PE (2001): The family herpesviridae: a brief introduction. In Fields Virology, (eds) Knipe DM and Howley PM. Philadelphia, PA. Lippincott, Williams & Wilkins; vol. (2): 2381-98.
10. Vittone V, Diefenbach E, Triffett D, Douglas MW, Cunningham AL and Diefenbach RJ (2005): Determination of interactions between tegument proteins of herpes simplex virus type 1. J Virol; 79(15): 9566-71.
11. Avrin AM and Prober CG (1999): HSV in Murray PR, Baron EJ, Pfaller MA, Tenover FC and Yolken RH (eds.). Manual of clinical microbiology. 7th edition. American Society for Microbiology, Washington, D.C.P.; 878:87.
12. Cullen AP, Long CD and Lorincz AT (1997): Rapid detection and typing of HSV DNA in clinical specimens by hybrid capture II signal amplification probe test. Journal of Clinical Microbiology; 35:2275-78.
13. Simmons A (2002): Clinical manifestations and treatment considerations of herpes simplex virus infections. J. Infect. Dis; 186 (Suppl. 1): S71-S77.
14. Ogilvie MN (2007): Herpes viruses. In: Medical Microbiology (eds) Devid Greenwood, Richard Slack and John Peutherer. Pub. Churchill Livingstone, Sixteenth edition, Chap. 42; 399-420.
15. Brooks GF, Butel JS and Morse SA (2007): Herpes viruses. In: Jawetz, Melnick and Adelberg’s. Medical microbiology. Pub. Appleton and Lange, Twenty-Third edition (2004); Chap. 33; 429-51.
16. Cohen JI (2000): Epstein-Barr virus infection. N Engl J Med; 343:481-92.
17. Callan MF (2003): The evolution of antigen-specific CD8+ T cell responses after natural primary infection of humans with Epstein–Barr virus. Viral Immunol; 16: 3-16.
18. Leen A, Meij P, Redchenko I (2001): Differential immunogenicity of Epstein–Barr virus latent-cycle proteins for human CD4(+) T-helper 1 responses. J Virol; 75: 8649-59.
19. Espy MJ, Uhl JR, Mitchell PS, et al. (2000). Diagnosis of herpes simplex virus infections in the clinical laboratory by LightCycler PCR. J Clin Microbiol;38:795–799.
20. Gonen C, Uner A, Cetinkaya Y, et al. (2006). Tonsillar abscess formation due to herpes simplex type-1 in a severely immunocompromised stem cell transplant patient with chronic myeloid leukemia. Transpl Infect Dis;8:166–170. doi: 10.1111/j.1399-3062.2006.00131.
21. Sahin F,Gereeker D,Karasartora D,Murat and Ozsan,T (2007). Detection of herpes simplex virus type 1 in addition to Epstein barr virus in tonsils using a new multiplex polymenase chain reaction assay, Diagn Microbiol Infect Dis;57:47–51. doi: 10.1016/j. diagmicrobi.09.013.
22. World Health Organization (1991). Virus safety guidelines for diagnosis and research laboratories working.
23. Efstathiou S and Preston CM. (2005). Towards an understanding of the molecular basis of herpes simplex virus latency. Virus Res; 111:108-19.
24. Pai PC. (2004). Prevalence of LMP-1 gene in tonsils and non-neoplastic nasopharynxes by Nested-Polimerase Chain Reaction in Taiwan. Head & Neck; 619-24.
25. Chagas AC, Endo LH, Santos WLC, Pinto GA, Sakano E and Brousset P (2006). Is there a relationship between the detection of human herpesvirus 8 and Epstein-Barr virus in Waldeyers ring tissues. Int J Pediatr Otorhinolaryngol; 1923-27.
26. Dias EP, da Rocha ML, de Oliveira MOC and de Amorim LM (2009). Detection of Epstein- Barr virus in recurrent tonsillitis. Braz J Otorhinolaryngol; 75(1): 30-34.
27. Nadal D, Blasius M, Niggli FK, Meier G and Berger C. (2002). Epstein-Barr virus (EBV) DNA levels in palatine tonsils and autologous serum from EBV carriers. J Med Virol;67(1):54–8. doi: 10.1002/Jmv.2192.
28. Winkler MT, Doster A and Jones C. (2000). Persistence and reactivation of bovine herpesvirus 1 in the tonsils of latently infected calves. J Virol; 74:5337-46.
29. Wat PJ, Strickler JG, Myers JL and Nordstrom MR. (1994). Herpes simplex infection causing acute necrotizing tonsillitis. Mayo Clin Proc; 69:269-71.
30. Tanaka N (2001). Infection of herpes simplex virus (HSV) and Epstein Barr virus (EBV) in acute tonsillitis-histopathological assessment by optical and electron microscope observation of biopsy specimens of tonsils. Nippon Jibiinkoka Gakkai Kaiho; 104:1093- 1102.
31. Razonable RR, Brown RA, Humar A, Covington E, Alecock E and Paya CV. (2005). Herpes virus infections in solid organ transplant patient at high risk of primary cytomegatovirus disease. J infect Dis; 192:1331-39.
32. Duffus WA, Mermin J, Bunnell R, Byers RH, Odongo G, Ekwaru P and Downing R. (2005). Chronic herpes simplex virus types-2 infection and HIV viral Load. Int J STD AIDS; 16:733-35.
33. Yoda K, Aramaki H, Yamauchi YS and Kurata T (1995). Detection of herpes simplex and Epstein-Barr viruses in patient with acute tonsillitis. Abstracts III International Symposium on Tonsils. Sapporo Japan; p.3
34. Endo LH, Vassallo J, Sakano E and Brousset P. (2002). Detection of Epstein-Barr virus and subsets of lymphoid cells in adenoid tissue of children under 2 year of age, Int J Pediatr Otorhinolaryngol; 66:223-26.

35- Endo LH, Sakano E, Camargo LA, Ferreira DR, Pinto GA and Vassallo J. (2003). The EBV action in tonsils and adenoids, Inter cong Series; 1257:265-