Category: Cloning

Introduction

Human cloning has been a controversial topic for centuries as scientists see its potential for treating the illnesses and flows of future peoples generations, but the procedure itself is complicated and morally questionable. Todays state of society and its medical abilities do not provide safe and ethical conditions for the mentioned process. At present time, human cloning should not be allowed due to the protection of peoples rights, avoiding objectivization of children, and procedural dangers.

Protection of Human Rights

Modern science does not allow the transportation of individual experiences and consciousness from one person to another. Human cloning focuses on genetic material but not cognitive characteristics. In other words, it allows for the DNA particles to be copied, but the potentially cloned person would still be a unique individual. Current laws do not provide guidelines for defining this new human as a member of society and a citizen of a particular country (Langois, 2017). Moreover, their psychological state may be unstable as they did not choose to be cloned and differ significantly from the rest of humanity. Unavoidable additional attention from the science community will likely affect the life of a cloned individual as well. They will have no privacy, personal interests, freedom, or choice of status. That violates currently accepted human rights that every modern person should be able to exercise (Langlois, 2017). Thus, potential human cloning requires new regulations in the spheres of jurisdiction and cognitive development.

Avoiding Objectivization of Humans

Making genetic duplication of people a standard and legal procedure could lead to human objectivization. Parents would be able to choose the genetic characteristics of their children, some military leaders might be interested in creating ideal soldiers, and the act of birth will stop being an evolutionary step. The cloned individuals could eventually be regarded as functional biological robots despite the feelings and complex behavior they would still possess being human (Franjic, 2019). The value of ones life is likely to decrease, although each person would probably still be unique, feel the pain, and have the desire to live. Eventually, such objectivization could lead to the emotional dysfunctionality of humankind.

Procedural Danger

Scientists have attempted numerous genetic experiments trying to clone mammals other than humans. Most of them resulted in failure due to the unpredictable behavior of biological material and the complexity of the procedure (Howard, 2016). A famous case of cloning a sheep in Scotland tested a somatic cell nuclear transfer technique with further development in a surrogate parent animal. It uses electricity shocking to start the cell growth stage, which is not a natural process. However, the mentioned method led to some successful procedures, and scientists began to use it in duplicating farmer animals. Unfortunately, even with modern technologies, less than ten percent of clones survived till birth (Howard, 2016, para. 3). Allowing such a high risk concerning human embryos is unreasonable and potentially psychologically dangerous for the impregnated women. Modern medicine does not possess the appropriate instruments to control the cloning experiments on humans closely.

Conclusion

Human cloning is a controversial topic debated by researchers and philosophers all over the world. The main factor is the personal identity of a cloned individual; he or she will be an independent person with feelings, emotions, and desires. Currently, human cloning should be prohibited due to the protection of a persons rights, the danger of peoples objectivization, and the unsafety of the procedure. Further consideration may become possible with the changes in social, moral regulations and technological advances in the sphere of genetic engineering.

References

Franjic, S. (2019). Ethical debates about cloning. Aspro Journal of Biomedical and Clinical Case Reports, 2(3), 93-98. 10.36502/20. Web.

Howard, L. (2016). Cow gene study shows why most clones fail. UCDavis. Web.

Langlois, A. (2017). The global governance of human cloning: The case of UNESCO. Palgrave Communications, 3, 1-16. Web.

In 1996, the successful cloning of a sheep stirred a tremendous debate around the ethics of this practice and its implications for the future of humankind. Indeed, once, cloning from a single adult somatic cell without sexual reproduction used to only exist in science fiction. Before 1996, not once had scientists succeeded in creating a genetic twin of a mammal. However, the 90s experimentations made cloning a reality, and frightening reality for many people. Public response was quick and overwhelmingly, one of grave concern. Once again, journalists became major influencers and shared their opinions with the general population. Some approached the issue without sentiment and outlined possible perspectives of cloning. Others, however, resorted to fear-mongering and deemed it necessary to warn their readers about the threats of this practice. This paper analyzes two articles by Kevles and Krauthammer with vastly different views and points out their strengths and weaknesses.

Kevles wrote a Study Cloning. Dont Ban It piece in support of legal and appropriately regulated cloning and managed to be outstandingly convincing while making his point. First, he challenged the very notion of an ethically acceptable practice. He gave an example of in vitro fertilization that was once seen as immoral and even akin to adultery. However, as time passed by and people were able to look at the advantages of that biological innovation, that type of fertilization became widely accepted. Kevles was sure that the same might happen with cloning. Further, according to the author, banning something often resulted in the prohibited practice going offshore and thus, off the radars of the authorities. Therefore, if cloning becomes forbidden, there will be attempts to clone illegally, which in turn will be extremely difficult to regulate. In his argument, Kevles called for greater acceptance and identified possible threats of cloning; however, he showed how they might be overcome, thus, providing a logical and level-headed response.

In Of Headless Mice& and Men, Krauthammer opposed the practice of cloning, and although he had a point, it became moot in the presence of the emotion that the author put in his piece. One characteristic of Krauthammers article that immediately stands out is an expressive language that encourages the reader to take the authors side. For instance, he called cloned mice animal monsters and the organs of the cloned creatures ripe for plundering. The author put together an appalling image that was bound to repel the reader. Furthermore, Krauthammer made some ungrounded claims, for example, he speculated that humans would be next to be cloned for the sake of organ transplantation. At that, he based his assumption on one biologists opinion on the feasibility of that happening. Although Krauthammers concern seemed genuine and one should indeed entertain the idea of cloning going out of control and breaching the ethical bounds, the author gave no alternative to banning it altogether. All in all, Krauthammers piece appears to be profusely emotional, and the lack of perspectives other than prohibition undermines his argument.

Every complex ethical issue, especially if it is caused by the emergence of scientific innovation, finds its supporters and opponents. Public opinion may shift considerably depending on how mass media presents the problem. This paper compared Kevles and Krauthammers arguments about cloning, and Kevles seemed to have made a stronger point. The author used logic, spared unnecessary sentiments, and offered a viable solution to keep cloning legal and regulated. His opponent, on the other hand, resorted to emotional pleas and failed to explain how a complete ban may help tackle the issues associated with cloning.

Introduction

DNA cloning and sequencing is one of the most essential techniques in molecular biology. This involves the insertion of a fragment of DNA into a vector, for example, a plasmid in order to create a new recombinant molecule (Stark, 1987). The green fluorescent protein (GFP) is a protein that fluoresces in blue light (Tsien, 1998). It has a typical beta-barrel structure with one ²-sheet and one ±-helix with a chromophore running through the center and has 238 sub-units of 26.9 kDa units (Yang et al., 1996). GFP generally refers to the protein first extracted from jellyfish Aequorea victoria. However, other derivatives of GFP exist. The GFP is mainly used as an expression reporter gene, but in advanced cases, it has been used in biosensor systems (Chalfie et al., 1994).

Two methods of determination of the sequence of a DNA molecule have been devised. One is the Maxam-Gilbert sequencing method, which employs the sequential chemical cleavage of DNA molecules, followed by the separation of the molecules on polyacrylamide gel. This method however is destructive as the DNA is denatured into smaller pieces and thus cannot be used in subsequent analyses. The other method is the Sanger method which uses dideoxy sequencing, and this method is now widely used in labs today. The Sanger method uses dideoxynucleotides to synthesize radio-labeled DNA sequence. The dideoxynucleotides only differ from deoxyribonucleotides in that they lack an OH group on the 3 end of the deoxyribose ring. For this reason, no additional nucleotides can be attached to the DNA chain hence effectively terminating the synthesis of DNA.

The following are the requirements for dideoxy sequencing to take place:

• DNA (template) which must be single-stranded. Double-stranded DNA must be denatured before carrying out the reactions.
• DNA polymerase is used to carry out DNA synthesis.
• A Prime. This is a short piece of single-stranded DNA that binds to the template DNA (usually an oligonucleotide -20 nucleotides long).
• Deoxyribonucleotides (dNTPs). A mixture of dATP, dCTP, dGTP and dTTP.
• A radio-active labeled deoxyribonucleotide. Usually, one of the deoxyribonucleotides should be radioactively labeled, so that the synthesized DNA molecules will be radio-active labeled too.

Aim of this experiment

The aim of this experiment is primarily to clone a fragment of DNA which includes the Green Fluorescent Protein (GFP) gene into the vector pTTQ18 which is an expression vector with a multi-cloning site located downstream from the strong Ptac promoter, and an ampicillin resistance gene to provide a selectable marker for the plasmid.

Materials and Equipment

• Plasmid vector pTTQ18
• GFP gene PCR product
• EcoRI enzyme
• Pstl enzyme
• 1% Agarose (gel) preparation
• Gel red dye
• E. coli bacteria
• DNA markers

Procedure

Step 1: Restriction digests and agarose gel electrophoresis

1. DNA from the plasmid vector pTTQ18 and a PCR amplification product that encodes a copy of the GFP gene was obtained.
2. Restriction digests of each of pTTQ18 and the GFP gene PCR product were set up in separate tubes with the enzymes EcoRI and PstI.
3. This preparation was then incubated at 370°C for 1 hour.
4. At the end of 1 hour, the samples were loaded from the restriction digest and ran on an agarose gel. The gel contained 1.0% agarose and a small amount of GelRed non-toxic fluorescent dye which was used as a substitute for ethidium bromide, which is a toxic dye. The basis of this step was to allow for visualization of the DNA under UV light after the run.
5. Then 4 ¼l 6× loading buffer was added to 20-¼l samples before loading the samples to the appropriate well. DNA markers which form a DNA ladder were loaded on the gel so that the size of the bands could be easily estimated.
6. The 1.0% gel was then run for 30 min at 100 V.

Step 2: Ligation

1. The restriction digested samples from the previous week were used to set up a ligation. An insert to vector ratio of approximately 3:1 was used for this exercise.
2. The tubes were then carefully labelled and placed in the rack that was provided. The ligation mixes were then incubated at 150°C overnight.

Step 3: Transformation

1. From the previous samples, 5 ¼l of the ligation mix was taken and added to 50 ¼l of competent E. coli JM101 cells.
2. This was then mixed and let to stand on ice for 30 minutes. The cells were later heat shocked at 420°C for 1 minute, and then incubated on ice for 5minutes.
3. To this was added 950 ¼l of LB, the contents mixed and then incubated at 370°C for 45 minutes.
4. Finally, 100 ¼l of the sample were plated onto L-agar ampicillin.
5. Overnight incubation at 370°C was then done.

Step 4: Observation

Observations of the colonies on the transformation plates were made and recorded, and the green and white colonies counted and recorded.

Step 5: Sequencing

One of the colonies was selected as an example colony, and then sequenced DNA isolated from this colony using primers GFP_F and GFP_R.

Observations

In this experiment, there is a PCR amplified segment of DNA containing the GFP gene. The plasmid vector pTTQ18 and the PCR product were digested with restriction enzymes and the desired DNA fragments gel-purified and ligated together with the enzyme DNA ligase to make a recombinant DNA molecule. The pTTQ18-GFP recombinant plasmid was then transformed into E. coli, allowing expression of the GFP gene and eventually making green fluorescent E. coli colonies. DNA sequencing was used to confirm the correct insertion of the GFP gene in pTTQ18.

Discussion and Conclusion

All of the DNA molecules generated from the above experiment were radio-labelled. Polyacrylamide gel electrophoresis was used to separate the DNA molecules, which were then detected by autoradiography. The samples from the four reaction mixtures were loaded into adjacent wells on the gel. The DNA fragments were then separated by electrophoresis according to their size (length). The shortest fragments of the proteins were located at the bottom of the gel.

The DNA sequence is read from the gel by starting at the bottom and writing, in order, the lanes in which the bands are found. In the experimental gel, the first two bands were found in the G lane, so the sequence can be said to begin with GG, then the next two bands are found in the C lane, thus this makes the next sequence to be GGCC. The complete sequence read from the experimental gel is:

5 GGCCTTATAGGTCCGTCGCGATTATTAAGTTGACGCCGTAGCTATGCC 3

Reading from the bottom upwards, the gel gave the sequence in the 5 32 direction.

References

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. & Prasher, D. (1994). Green Fluorescent Protein as a Marker for Gene Expression, Science 263 (5148), 8025.

Stark, M. J. (1987). Multicopy Expression Vectors Carrying the Lac Repressor Gene for Regulated High-Level Expression of Genes in Escherichia Coli. Gene 51, 255-267.

Tsien, R. (1998). The Green Flourescent Protein, Annu Rev Biochem 67, 50944.

Yang, F., Moss, L. & Phillips, G. (1996). The Molecular Structure of Green Fluorescent Protein, Nat Biotechnol 14 (10), 124651.

Cloning can be a topic for science fiction or thrillers. Nevertheless, it became a reality when animals began to be cloned. Although cloning sounds exciting from the perspective of technology and genetic engineering, I do not support the idea of human cloning.

I would not like to be a clone of either my parents or someone else. First of all, I am interested what is the purpose of such an experiment. Even if this clone had to save the universe, I would not agree to this action. My classmates say they would like to be clones of their parents to acquire some positive characteristics of them. However, I do not see any sense in it because one can learn and train some skills or strive for self-improvement. Moreover, it looks more valuable to retain my uniqueness and identity. Thus, authenticity plays a more critical role in the general development of our planet.

Another reason to argue against cloning is the ethical issues of this practice. It seems immoral to clone a human that can develop abnormalities and die early (Nwoye, 2019). In view of this, cloning contradicts the concept of human dignity and has nothing in common with the protection of peoples lives. None knows how the clones personality will evolve and whether the clone can be self-sufficient. Besides, this can have irrecoverable consequences in psychological and social terms.

To conclude, when we look closer at the issue of cloning, we can assume that it is not attractive from various perspectives. Cloning cannot retain the uniqueness of a human and can damage a person psychologically. Moreover, there are many ethical issues around this phenomenon, which make it dangerous.

References

Nwoye , L. (2019). Ethical issues in human cloning. International Journal of Humanities and Innovation, 2(4), pp. 125128.

Modern society has been equipped with the technology that has revolutionized almost every aspect of life. In Science and Medicine, latest advancements have become a remedial source for various health related problems. However, it is well known that controversy exists or surrounds science through several forms.

Due to this, new debates have invaded the society giving a problematic twist to a new invention or discovery. One such issue to be described here is cloning. Cloning is a strategy to reproduce and develop a living organism by retaining all its identical features (Revel, 2000). This would mean obtaining a Photostat copy of the original one.

Basically cloning experiments are related to field of genetics. The area of cloning that has been under debate is Reproductive Cloning. This is achieved when nuclei from cells of adult animals get transferred into the enucleated oocytes of nuclei from embryonic cells (Revel, 2000). The embryonic cells may be of different animal. As such, this would lead to creation of surrogate mothers which has become a questionable issue and initiated the debate.

Hence the research question is how far the reproductive cloning has taken various controversial shapes since its inception. The purpose of bibliography is to find appropriate information relevant to the debate under question and provide a solution with a convincing justification. The criteria used in selecting the sources is that the articles should highlight a questionable issue relevant to the cloning in the description.

The sources that are related to the cloning but does not highlight issue or debate and that seem to promote the utility and acceptance of cloning are excluded. The first description in the scientific literature is that of sheep cloning from an adult cell in1997 (Revel, 2000). According to this study, its impact on the benefits or utility of reproductive cloning in human medicine has led to the imagination of creating human individuals (Revel, 2000).

On moral grounds and irrelevant worries, it has received wide condemnations due to the wrong belief that genetic identity is nothing but two personalities who share identical features (Revel, 2000). This article is very useful as it has not only given the basic definition of reproductive cloning but also highlighted how the first discovery has opened a new gateway to controversies.

The relevance of the research question to the topic can be better strengthened by categorizing the articles on Human cloning. This is because it is well known that controversies have arisen when a new technology was put forward related to Human cloning.

This would cause disturbances to the ethical or legal values in the society (Bernstein, 2002). Hence, a paradigm for enabling the law to react in conditions when new technology invades the society needs to be given prior importance (Bernstein, 2002). This may be due o the fact that unmarried women would come up in the society as surrogate mothers in the twenty-first century (Bernstein, 2002).

This article is very useful as it is highlighting about the consequences of cloning in terms of ethical and legal issues and creation of surrogacy.

Lee (2004) described that the choice of reproductive cloning although is a human right, necessary restrictions need to be imposed to save the decorum of human society by maintaining a balanced approach.

Since the in depth knowledge regarding cloning technique is not totally adequate, the application is more likely to contribute to risk rather than benefits (Lee,2004).

Further this article, emphasized the need of a ban on cloning which is appropriate. Hence, this article is useful in the present context that it has raised questions regarding the value of human dignity and rights when cloning is implemented.

Parker (2003) described that cloning has received widespread concerns from different spokespersons at various places and these do not agree with one another. These may deviate the moral values and tend to increase the vagueness about the basic research on which the controversies and policy decisions finally depend (Parker, 2003).

This article has also made it clear that regulations imposed by authorities often have conflicting opinions that imbalance the issue and promote the opposite principles rather than supporting the main principles on the honest side (Parker, 2003).

This article is useful in the present context as it has well documented the pros and cons of various opinions on a common platform. It has furnished insights on the continuing debate cloning have been receiving.

Camporesi and Bortolotti (2008) emphasized on the negative attempts made in 2006 with regard to the human reproductive cloning. This was compared with the therapeutic cloning and shed light on the possible chances of human cloning in the near future when it becomes acceptable on all grounds (Camporesi and Bortolotti, 2008).

This article has strengthened the policy issues that interfere and contribute to the difficulties in accessing the human reproductive cloning on moral perspective (Camporesi and Bortolotti, 2008).

However, debate is still fresh unless human reproductive cloning was made successful by random interactions between different policy speakers and institutions(Camporesi and Bortolotti, 2008). Because they could guide the vivid rules on the utility keeping in view of disagreements, clear moral values, and widespread people contacts(Camporesi and Bortolotti, 2008).

This article is useful in the present context as it has shed light on the debate and its effect on the society inspite of successful of imaginations that cloning would be a reality in the near future.

References

1. Revel, M. Ongoing research on mammalian cloning and embryo stem cell technologies bioethics of their potential medical applications. Isr Med Assoc J 2 (2000):8-14.
2. Bernstein, G. The socio-legal acceptance of new technologies: a close look at artificial insemination. Wash Law Rev 77.4 (2002):1035-120.
3. Lee, M, L. The inadequacies of absolute prohibition of reproductive cloning. J Law Med. 11.3 (2004):351-72.
4. Parker ,M. Reasoning about embryos, cloning and stem cells: lets get more clear and distinct. Monash Bioeth Rev. 22.1 (2003) 8-17.
5. Camporesi, S and Bortolotti, L. Reproductive cloning in humans and therapeutic cloning in primates: is the ethical debate catching up with the recent scientific advances? J Med Ethics. 34.9 (2008):e15.

Southern blotting can either be used in the determination of small fragment of a single gene or a large DNA sequence such as part of the genome of an organism. Therefore southern blotting is an invaluable tool in DNA technology. This method was discovered in the 1970s by Edward Southern

in Edinburg University and since then it has found use in various areas of science including molecular biology and DNA technology.. Annealing of the probe with a DNA of known sequence makes the determination of probe sequence obvious to the complementary nature of the double stranded DNA¹.

Gene cloning also referred to as DNA cloning in the recombinant DNA technology is the procedure of creating multiple copies of fragments of isolated DNA by in vivo or in vitro methods or reproduction of fragments of DNA.DNA cloning can either be based on cells or achieved by using polymerase chain reaction(PCR).

In the approach based on cells both the replicating molecule or the biological vehicle known as the vector and the foreign DNA fragment are cut using the same restriction enzyme(s ) to produce compatible cohesive (sticky) or blunt ends on the DNA molecules, then the foreign DNA fragment is permanently joined to the DNA of the vector using an enzyme known as DNA ligase which catalyzes the formation of a phosphodiester bond between the two DNA chains thus producing a chimera or a recombinant DNA molecule.

The replicating molecule is meant to carry the foreign DNA fragment into the host cell. Bacterial plasmids are commonly used as cloning vectors in most laboratory experiments².

DNA cloning involves the following steps;

1. DNA recombination-This involves the identification and isolation of the DNA fragment containing the gene of interest from the chromosomal DNA using restriction enzymes or by using the polymerase chain reaction(PCR),gel electrophoresis and sonication of DNA. The fragment of DNA isolated must be joined to a replicating molecule or vector which acts as a vehicle that transports the DNA into the host cell. Both the isolated DNA fragment and the vector are cut using restriction enzymes at their restriction sites into sizeable fragments suitable for cloning. The desired DNA fragment is inserted into the cut ends of the vector and permanently linked using the enzyme DNA ligase thus forming a recombinant DNA molecule or chimera, but in some instances if processed under in vivo conditions, the enzyme terminal transferase may be added in order to avoid free sticky ends to rejoin instead of forming a chimera since it catalyzes the addition of tails of the nucleotide to the 3ends of the DNA chains³.
2. Transformation-This is whereby the recombinant DNA molecule enters the host cell (which is usually a bacterium) and proliferates. The recombinant plasmid molecule also contains color selection markers which show white/blue screening on a media of X-gal.
3. Selective amplification-Within the host bacterium the vector multiplies producing numerous identical copies not only of itself but also of the gene that it carries.. After a large number of cell divisions, a colony or a clone of identical host cells is produced.
4. Isolation of desired DNA clones-Culturing of transfected cells is done. The selectable antibiotic resistance markers are used as well as the color selection markers if present in the recombinant plasmid, though further confirmation is done using PCR, DNA sequencing and restriction fragment analysis.

Results

The isolated DNA was purified and placed on electrophoretic gel and the results were as shown above. Fragments were eluted in terms of their sizes. The specific DNA fragments were then blotted on a membrane appearing as show above.

The DNA was then denatured using sodium hydroxide to separate the strands to allow or annealing with the probe. The denatured DNA strands appeared as shown above. The probe DNA was then labeled with a radioactive marker.

Discussion

Purification of the DNA fragments is important to ensure the integrity of the results. In an experiment aimed at determination of a portion of a large DNA fragment it is important to eliminate the sequences that have not been affected by specific enzymes. Consequently, the presence of these fragments may affect the clarity and the precision of the results.

Conclusion

Human cloning

The aim of this paper is to critically analyze the controversial issue of human cloning. It will begin by defining what human cloning is, the history of human cloning and finally the pros and cons of this science as presented by those for and against it.

The genesis of cloning can be traced to 1950s when scientists started cloning frogs. Human cloning refers to the production or creation of a duplicate of a human tissue, human cell or human being. There are two kinds of human cloning and they include: reproductive cloning and therapeutic cloning.

Reproductive cloning is aimed at making a human being through cloning whereas therapeutic cloning is the employment of cells from adult individuals for medical purposes. This approach is sometimes referred to as a nuclear transfer. It is feared that the same approach may be employed to clone human beings.

These cells have the ability to differentiate into all body tissues and researchers are optimistic that ability to direct these cells to develop into desired implants, which enable the treatment of many diseases. Presently the main source of these cells is discarded embryos resulting from fertility complications. Were it not for the ethical and other controversial issues surrounding human cloning, it would have provided a continuous supply of these for stem research.

Pros and cons of human cloning

The proponents of human cloning use scientific benefits that this new technology is able to give to justify their course of action. These benefits include, elimination of genetic disorders, enabling sterile couples to have children and possibility of creating donors to supply organs for transplant. Others have given the possibility to clone people who are already dead and those who are aging (Guardian, 3).⁴

The opponents of this technology and other related technologies do not overtly employ religious dogma in the justification of their opposition. Countries like America which are ruled or guided by a non-religious constitution should allow sectarian creeds to rule them. The opponents rely mainly on the belief and not on research findings.

According to the new times (2) if a research concludes that GMOs are safe for use may satisfy traditional Christians in the city of Kansas in the united states , but will not be able to Stockholms post-Christians (Christians in the modern world) from doubting Franken food (GMO).

Some key opponents of the human cloning research, like Leon Kass, claim that their business is not defending the belief of Judeo- Christians, but the dignity of mankind. Dr. Kass , one of the leading opponents of this technology in the united kingdom, claims that the book of genesis describes the special status of human beings.

According to him, this special status should be heeded because of the cosmological truth reflected by the message and not the basis of the biblical authority (New York Times, 2).

These articles by the New York Times also indicated that people from different places like California, had voted in support of the cloning using embryos and have even volunteered in support of it. According to the Christian institute Magazine (5), both therapeutic and reproductive cloning methods result in the creation of a new life.

Since life is considered sacred from the time of conception, hence the destruction of the embryos in therapeutic research for the purpose of obtaining cell for stem research is unjustifiable and amounts to killing. The prolife groups term this technological cannibalism.

when DNA was proposed by a famous pioneer in the field of criminology, Alec Jeffreys. He detailed various forensic techniques such as typing and DNA fingerprinting that was new and modern at the time. DNA sequencing developed into a profession and has assisted many law enforcers in the prosecution of offenders through the presenting evidence in a court of law.

Examples of where DNA can be obtained from include, hair, semen and skin samples. This information is stored in large databases and search queries regarding suspects can be found from them. These two fields are fast becoming the modes in which terror cell can be unraveled and terror plots against the state and its citizens unraveled.

Researchers and scholars have confirmed that there is a definite similarity in the chemical structure of deoxyribonucleic acid in every individual. The difference occurs in the series of base pairs. These differences can be detected through DNA fingerprinting. The process of fingerprinting can prevent terrorism through profiling of suspects and people placed in the most wanted list.

The state has a large database that samples frequent crime offenders such as rapists and other violent individuals. Terrorist are people who have a have a history of conducting other crimes. It is through the effort of DNA implemented by local law enforcement agencies, that we can positively identify potential terrorism and prevents any plots that they may be planning against the state.

These two instruments of forensics play a big role in the identification and arrest of suspects involved in activities that may lead to the death of innocent lives in any country. Digital forensics is used in collaboration DNA sampling to positively match individuals. There are times that DNA can be used to match a suspect who has committed electronic fraud. The fraud can be further supported through evidence acquired through Digital forensics.

Most scientists are against the use of human cloning for reproductive purposes. Among them is the British embryologist, Wilmut and Richard Gardner. Wilmut played a central role in the cloning of Dolly and Gardener was the chair of the royal society concern with human cloning. They both claimed that at present there are too many risks.

According to professor gardener, the experience with animals has given a clear indication of the possibility of producing an individual with extreme deformities never witnessed before. Many religious organizations are of the opinion that human cloning may result in ethical issues like emergence of embryo black market, designer babies and the formation of a genetic underclass.

According to Kitcher (61) human cloning should be considered as either good or bad on the basis of the ultimate goal for which it is being carried out for. For example if it is aimed at producing a human being with certain characteristics, then it is wrong. But if it is aimed for medical purposes then it is justified. He employs three examples to drive his point home.

One of these examples is the scenario of a dying child and the only treatment that could save his life is a kidney transplant with a ten year period. Unfortunately the kidneys from both parents are not compatible and it is rare to get individuals with compatible kidneys. Were it allowed to clone a brother, kidney transplant would have been very simple and very fast.

The second case is that of a widow, who has lost the husband through an accident, her daughter is in comma and she has reached menopause. The question whether this widow could be justified to take an egg from a surrogate mother and a cell from her daughter to create a clone of her dying through a surrogate mother is difficult to give a direct answer⁵.

To the present time no attempt has been undertaken to practically clone a human being due to ethical and moral issues surrounding this issue. From the view point of the researchers, if well used the human cloning will have enormous benefits mainly in the field of medicine but if misused the consequences are unimaginable.

From the perspective of the religious people and other opponents of the research practice, the approach is unacceptable and unjustifiable as it is seen as unethical under the religious believes.

Bibliography

McFarland, D. Preparation of pure cell cultures by cloning. Oxford Publishers, London, 2009.

McLaren, A. Cloning: pathways to a pluripotent future. Wiley Publishers, Perth, 2000.

Perrone, J. Government legislation designed to prevent cloning of human beings is on track. Oxford Publishers, London, 2005.

Tierney, J. Are Scientists Playing God? It Depends on Your Religion, CRC publishers, New York, 2007.

Kitcher P. There will never be another you. University of Illinois Press, Chicago,2007.

Footnotes

1. D. McFarland, Preparation of pure cell cultures by cloning. Oxford Publishers, London, p. 25.
2. P. Kitcher,. There will never be another you. University of Illinois Press, Chicago,2007, p. 56.
3. A. McLaren, Cloning: pathways to a pluripotent future. Wiley Publishers, Perth, 2000, P. 105.
4. D. McFarland, Preparation of pure cell cultures by cloning. Oxford Publishers, London, p. 25.
5. J. Tierney, Are Scientists Playing God? It Depends on Your Religion, CRC publishers, New York, 2007, p. 28.

Cloning is the manufacture of an organism identical to one that already exists. Several types of cloning are practiced among human beings: these are reproductive cloning, therapeutic cloning, and replacement cloning (Playing God?, par 2).

Although Cloning has given rise to several social-ethical implications, especially in the matters concerning family, there are still many reasons to consider accepting cloning in the society. The benefits that come with cloning outweigh the possible risks and this will help in fulfilling Gods plans for the humans.

Cloning has several advantages that make it useful to the modern world; it has numerous applications in medicine, as well as in the field of agriculture. Cloning provides identical animals that are needed for research purposes; this facilitates the rapid production of animals with desired traits (Playing God?, par 3).

The application of the nuclear transfer technology in the field of agriculture ensures faster breeding. With cloning, there is a possibility of transgenic propagation of livestock. These kinds of animals are utilized for organ transplantations and immunity boosting through consumption of products from genetically modified products that are more nutritive (Playing God, par 1).

Cloning applies the idea of gene alteration, which is significant in the improvement of productivity and health of livestock and crops, this ensures that the plants and animals are even more adaptable to the new environment and therefore have more survival skills and adaptability; this means that the humans are protecting Gods creations from extinction through this technology.

For humans to protect and take care of Gods creations they need to, first of all, take care of themselves, they need to survive in the future, they need to be healthy and strong, they need to live as long as possible (Playing God, par 4). Cloning will offer them these opportunities.

Many bright people that lived in the past did not have an opportunity to continue their generation line as they were infertile, the use of reproductive cloning will ensure that such bright-minded families are not extinct and their input will be a vital ingredient for future survival.

Cloning can be utilized in protecting human beings from extinction, for example the laboratory production of the bone marrow, which is a potential cure for the deadly cancer disease threatening the human existence can be overcome; if it is successfully implemented than the humans will always be around to ensure that life is continues on earth.

Sickle cell anemia is a deadly genetic disease as well, it can be eliminated through cloning; this is a great achievement for human beings that should not be ignored.

When God created human beings, His intention was to protect his creation. Before human beings advanced in science, so many formally existing species of plants and animals were extinct. The discovery of cloning may offer human beings a chance to correct this anomaly by regenerating this species, thus allowing for their existence (Playing God, par 6).

They will be fulfilling what God indented for them. So many natural calamities is a threat to the existence of living beings, human beings have created a seed bank that is to ensure that living beings are not extinct from this planet, the only way that will ensure such creatures exist in the future is through cloning. Cloning is therefore a Godly thing, as it will offer his creation a surety of existing in to the future.

God created human beings in his own image and likeness, this means humans are alike with God; they are his images on this planet. If a person sires a child, he/she expects the child to be like him/ her, and therefore carryout themselves in a similar manner.

Humans are not just God creation, they are Gods children, and are supposed to be powerful like he is, cloning gives humans a chance to prove to God that they are worth being his sons and daughters as they can carry out extra ordinary things like God himself (Playing God, par 8).

Cloning does not create mater; it simply utilizes already available mater to humans advantage, humans are simply utilizing what God has put in place for them to protect themselves and his creation, this signifies Gods intention for the humans to be protectors as he is (Silver, p 10).

As much as cloning is vital for existence of life in the future, it has in some cases encouraged sin. It has been used to encourage homosexuality as it offers homosexuals a chance to have children that share their genetic make-up. Since time immemorial, God has been against homosexuality, this therefore makes cloning un-Godly.

Religious societies suggest that clones may not have souls and therefore lack what links humans to God (Is Cloning Embryos Playing God, par 6). This makes the whole process un-Godly as it prevents the clones from identifying themselves with God and hence do not worship God.

It is undisputable that cloning has controversial circumstances that may seem to be un-Godly. However, it is evident that humans can fulfill Gods plans for them if cloning is implemented with the right intention in mind. Cloning therefore is NOT playing God provided it is done morally and ethically.

Works Cited

Is Cloning Embryos Playing God. The Voice Magazine. 2011.

Playing God. Creationism versus Science. 2007.

Playing God? Facts and Thoughts on Human Cloning. Activated Magazine, 2003.

Silver, Lee M. Remaking Eden: The Benefits of Cloning. New York: Avon Books. 1997. Print.

Genetic cloning is a biotechnological manipulation whose result is to create a genome-identical clone for a given species. Cloning any species, from E. coli to humans, is a matter of time and technical sophistication, so it is highly likely that after the relatively successful experiments to create a somatic clone of Dolly the sheep in 1996, the scientific community will reach the possibility of complete cloning of the human body (ED). This essay offers diametrically opposed views on the phenomenon of cloning based on the goals pursued by researchers.

The creation and development of such an instrumental method is undoubtedly an undeniable advantage of research thought. Cloning provides freedom for asexual couples, providing possibilities for the birth of a child even when one of the parents is dysfunctional. This includes reproductive freedom because if cloning technology develops, even same-gender couples are given the opportunity to create their own child. The clone born does not necessarily have to have identical traits to the parents since the phenotype is determined not only by the genotype but also by the environment in which the individual is raised (Xue et al. 13847). In other words, reproductive freedom made possible by cloning procedures will free individuals from the burden of having or not having a child and equalize the rights of people of all genders.

The development of cloning technologies does not mean that the researchers goal is to create a complete copy of an adult human being. On the contrary, once the cloning of a species is established, these procedures can be used to grow biocompatible organs or tissues for transplantation to a patient in need. This technology can solve the problems of tissue incompatibility, transplant waiting lists, and donor shortages and will significantly improve the survival rate of patients even with acute, chronic diseases in which organ function is being destroyed. Growing individual organs created by cloning technology will also prove helpful for research purposes, as such organs can be used as drug testing media instead of animal testing.

On the other hand, genetic cloning of a species is not an absolute panacea but rather is associated with severe drawbacks affecting the development of this technology. One of the critical concerns is the development of the illegal organ-selling business, as well as the manipulation in which the DNA of individuals is isolated illegally and used for terrorist purposes. Creating clones of political and cultural figures and using them for criminal purposes can present dangers  for example, if terrorists have stolen genetic material from a president to either subsequently study the politicians genome or grow a clone and kill it demonstrably. It is not difficult to extrapolate that human cloning would create a degrading phenomenon in which human production is seen as an illegal business to produce enslaved people and organ factories. At the same time, if human cloning has reached a massive scale, it significantly reduces the biodiversity that nature intended. In this case, the mechanisms of evolution are further disrupted, causing damage to population health eventually.

Another problem with genetic cloning is the legal and moral issues associated with clone birth. From a biological point of view, a born individual is treated as an identical clone of an adult. From a legal and moral perspective, however, this creates questions about what kind of name it should have, whether it should have a unique identity and whether it should have rights and responsibilities equal to other residents of the state. Cloning will almost certainly lead to the development of psychological disorders in which the clone will feel limited in his life choices and predetermined in his fate, which can lead to suicidal patterns in clones.

Thus, cloning of this kind is not a completely unambiguous tool but instead has both advantages and disadvantages. It is precisely because of the plurality of opinions regarding cloning that one cannot be strictly convinced of the necessity or otherwise of cloning. The technology will almost certainly become available in the coming decades, but the legal and moral issues of this will be the critical limiting factors for the development of the technology.

Works Cited

ED. Celebrating Dolly the Sheeps legacy, 25 years on. The University of Edinburgh, 2021.

Xue, BingKan, Pablo Sartori, and Stanislas Leibler. Environment-To-Phenotype Mapping and Adaptation Strategies in Varying Environments. Proceedings of the National Academy of Sciences, vol. 116, no. 28, 2019, pp. 13847-13855.

DNA cloning technique

Cloning is the process of transferring a gene from its natural chromosomal to an autonomous vector so that to replicate. During the process of cloning, the DNA is transferred from the cells and manipulated in a test tube and the new DNA is consequently returned into cells (Lodege et al., 2007, p. 279). Since the genetic information of E. coli was initially well characterized, it has been the instrument of choice for DNA manipulation. One of the required combination vector and new DNA has been constructed in E. coli; the construct can be placed in other types of cells (Lodege et al., 2007, p. 282). There are two approaches to reproduce DNA; the Polymerase Chain reaction and the Cell-based process. This study will use the latter approach where the vector pTTQ18 will be used for expression. The vector also has to contain a very important gene, the antibiotic resistance gene. This study uses an ampicillin resistance gene to conduct the cloning process.

Green fluorescent protein (GFP)

The Green Fluorescent Protein has been in existence for a long time probably over one hundred million years. This unique protein is found in a particular type of fish naturally, a jellyfish called the Aequorea Victoria, this protein is expressed in the photo organs and coded for by a single gene that has been isolated (Chalfie & Kainnzm, 2006, p. 1). The GFP gene can be inserted downstream of the promoter in any other gene from any other animal and be replicated. Because of the fluorescent properties of this gene, it has been the most commonly used reporter protein. An aequorin protein in jellyfish gives off blue light when it binds with calcium. The blue light is consequently absorbed by the GFP gene and in turn, gives off green light. The RNA polymerase is a useful enzyme in the process and it helps in binding the promoter area and induces transcription. If the GFP gene is well inserted in the plasmid correctly, it can be expressed in other organism like pigs and worms among others (Chalfie & Kainnzm, 2006, p. 3).

The GFP gene is helpful in observing when proteins are made and where they can be taken. The GFP gene is attached to the specific gene for the protein under observation. When that protein is made, it will contain GFP. With GFP fluorescence characteristics in play, the protein can be seen when light is shone and green light is given off (Chalfie & Kainnzm, 2006, p. 3). The GFP gene is for that reason a vital visual tag that assists in the observation and analysis of other genes expression.

The plasmid vector pTTQ18

In modern laboratories, researchers purify recombinant Taq DNA polymerase and assay for its pertinent role in the DNA. The E. coli will be used for purifying the recombinant protein (Society for General Microbiology, 2007, P. 161). The E. coli is used because it contains the pTTQ18 plasmid which in turn contains Taq DNA polymerase I gene that has been cloned behind a very strong and repressible promoter known as the Ptac promoter. This promoter comprises the 10- and 35- regions of the Trp operon promoter and LacO aspect from the lac operon. pTTQ18 also has the lac I gene and the marker gene for Ampicillin (Society for General Microbiology, 2007, P. 161). The reason for using this plasmid instead of using pGEM/Taq plasmid is that the pTTQ18 is a better option for expressing the gene as it has a very strong promoter hence very reliable.

The restriction enzymes

Restriction enzymes and plasmids form the basis of developing the cloning technique. The restriction enzymes have the ability to destroy infecting viral DNA without damaging the DNA of the host bacterium therefore the modification system works as a type of immune system for single bacterial strains safeguarding them from foreign DNA infection (Wong, 2007, p. 69).

The restriction enzymes form a junction as part of the restriction-modification structure. A matched modification can recognize and modify the nucleotide sequence that was recognized by the restriction enzyme, this is normally by methylation (Wong, 2007, p. 69). The methylated DNA is hence protected from cleavage by the restriction enzymes. The restriction enzymes otherwise called endonucleases can identify exact nucleotide sequences in DNA and cut both of them. There are two types of restriction enzymes namely class I and class II enzymes. Not all these enzymes cut the sequences at specific sites. Class, I enzymes include EcoB, EcoPI and Ecok while examples of class II enzymes include EcoR and PstI (Wong, 2007, p. 72).

Reference List

Chalfie, M & Kainnzm, S. (2006). Green Fluorescent Protein: Properties, Applications, and Protocols, New York: John Wiley And Sons

Lodege, J., Lund, P.A & Minchin, S. (2007). Gene Cloning: Principles And Applications, London: Taylor And Francis

Society for General Microbiology, (2007). Microbiology, Volume 153, Highwire Press

Wong, D.W.S., (2007). The ABCs of Gene Cloning, Boston: Birkhauser

Introduction to Cloning

Cloning is a biotechnology tool that uses the genes of a biological species to create an identical copy. In the past scientists have cloned basic cells and genes, and even complex organisms such as sheep. A complex organism is a multicellular organism with many different types of cells such as skin, blood, or liver cells. The copy that is created from the original is called a clone. Cloning takes away a part of the “cultural inheritance” that humans achieve through the transmission of experiences and history (Ayala) but it allows for revolutionary forms of medicine to be invested in and studied. Even if cloning an entire organism is controversial, cloning specific cells allows for gene therapies to be created that will allow for the standard of life for millions of people to be increased. Some theories even believe that genetic engineering would allow humans to cure hereditary disease (Singh).

The concept of cloning began in 1938 with Hans Spemann but failed to make strong strides until the 1980s. Soon after the discovery of DNA, in 1978, David Rorvik released a book titled “In His Image: The Cloning of a Man” that began a controversial debate on the ethics of cloning. Revolutionizing the concept of cloning genetic data and healthy cells was life-saving because looking for perfect match bone marrow donors was difficult. In the early 1970s, the concepts of gene therapy were raised (NIH). It advanced to researchers manipulating viruses in order to “deposit the DNA for the desired gene” to insert genetic material into the virus (NIH). The first human trial was in 1990 for a four-year old girl who needed help with treatment against her genetic disease. It was successful and the cells were placed to “provide longer-lasting benefits” for her.

This research paper will further expand on the process of somatic cell gene therapy and how exactly it works technically and ethically. Somatic cell gene therapy places genes in the somatic cells and aims to cure diseases in that person, not their descendants. I will also focus on the problems or dangers of gene therapy and any side effects or negative facets it might have. Understanding specific genetic disorders and gene therapy methods that are being studied, this paper will also focus on cystic fibrosis specifically and how gene therapy has helped create treatments that could lead to a long term treatment that solves the genetic disease.

Goals of Cloning

One of the main purposes of cloning is to create healthy and functioning stem cells, because they repair, build, maintain our body and therefore can be manipulated to help repair tissues and organs in the body. In the past, stem cells have been transferred through bone marrow transplants but those result in lots of failed results where the body’s immune system does not accept the transplant. Cloning would allow for genetically identical stem cells for each individual. In fact, “In 2013, scientists at Oregon Health and Science University were the first to use cloning techniques to successfully create human embryonic stem cells” (Learn Genetics Utah).

In order to create identical genetic material, scientists have focused on gene cloning. Gene cloning specifically focuses on producing “copies of genes or segments of DNA” (Cloning Fact Sheet). It has a completely different process than reproductive or therapeutic cloning. With gene cloning, my research will specifically focus on its benefits with gene therapy, including using specific genes to create biopharmaceuticals targeted to help people. For centuries humans have had genetic diseases that only recently were identified but were still unable to be cured. Gene therapy is an unprecedented science because it is a form of cloning that is revolutionary in its goals and methods.

Specifically, “gene therapy involves altering the genes inside your body’s cells in an effort to treat or stop disease” (Mayo Clinic Staff). Mutated genes can cause disease so research and advancements in gene therapy allows doctors and scientists to try to create a normal copy of a gene that is mutated. It can assist people with disabilities by trying to fix nonfunctional genes that do not perform the tasks the healthy human body is supposed to. If conducted properly, “gene therapy is defined as the introduction of genetic material via techniques of molecular biology into somatic cells [in contrast to germ cells] to treat or prevent disease.” (McCain).

Replacing a mutated gene allows for cells that have become diseased due to genes that do not work correctly to then be able to start helping to treat certain diseases they could not fight before. For example, “A gene called p53 normally prevents tumor growth” and if it is replaced where it is missing then it can cause cancer cells to be eliminated (Mayo Clinic Staff). Fixing mutated genes inhibits diseases because the mutation is, in a sense, “turned off”. Doctors and scientists would also be able to use gene therapy in order to condition a person’s immune system to recognize and attack diseased cells.

The specific procedure of gene therapy is done through clinical trials that are conducted in different ways. Clinical trials help scientists test whether certain medicines or practices are safe to use on people. To complete a specific type of gene therapy includes blood or bone marrow being drawn from a large needle, exposing that sample to a virus that contains the desired genetic material, and that virus being injected back into a person’s body with the altered genes (Mayo Clinic Staff). A gene is inserted into a cell that does not function through a vaccine or IV by using a virus as a vector in order to deliver the gene. (NIH). Once inserted, the virus disassembles and delivers the genetic data into the nucleus and they are modified not to create diseases but rather to restore the function of the protein that is malfunctioning. (NIH).

By adding a new gene if one is missing or replacing a mutated one, people born with defects such as being unable to fight disease or having a disability will be helped. Gene therapy is relatively new and since 2000 has already proven helpful in helping create long and short term solutions for cystic fibrosis, X-SCID disease, and more. The development of gene therapy will allow for replacement of defective genes, alteration of an aberrant gene, or introducing pharmaceuticals in genes that can assist with the eradication or treatment of a disease. So far, gene therapy has shown to be successful in treating diseases such as leukemia, blindness, hemophilia, and immune deficiency (Mayo Clinic Staff).

Cloning Applied to Cystic Fibrosis

Cystic Fibrosis is an autosomal-recessive genetic disease that causes lung infections and limits the ability for a person to breathe (CFF). Mutations in the Cystic Fibrosis Transmembrane Conductance (CFTR) gene causes the protein to not be able to move chloride to the cell surface to attract water and therefore the mucus in the lungs clogs the airways and traps germs leading to complications (CFF). Gene therapy is revolutionary with cystic fibrosis because it takes correct copies of the CFTR DNA to the epithelial cells in the airways (Burney and Davies). Without It is still a difficult process because Cystic Fibrosis is a life-long disease and therefore the procedure has to be repeated multiple times. Currently, scientists are working on the clinical efficacy of Cystic Fibrosis gene therapy treatment so that the mutation can be solved long term for human beings.

Cloning Risks & Regulations

Risks included with gene therapy circle around the fact that the gene usually has to be manipulated by inserting it into a virus which has risks. The original diseases-causing genes are removed but “your body’s immune system may see the newly introduced viruses as intruders and attack them” (Mayo Clinic Staff). Other risks also include viruses targeting the wrong cells, such as healthy cells which would damage them. The virus can also cause infection due to unpredictability of exactly how it will react, sometimes even leading as far as causing a tumor if it is inserted incorrectly into the wrong spot in a person’s DNA. The risks are due to the modernity of the science behind gene therapy, the techniques are fairly new so institutions such as the U.S. Food and Drug Administration continue to regulate research. Although there has been almost miraculous work performed with gene therapy, there are still many developments that need to be made “particularly in the areas of gene delivery and cell transplantation” in order for it to be replicated and performed on a larger scale (Mulligan).

The ethical issues that revolve around gene therapy continue to place the safety of the research in the highest regard, but that results in a slower movement of the innovations with gene cloning. The main ethical problems regarding gene cloning include distinguishing the moral line between good and bad, drawing a line between the “disabilities” and normal traits” that gene therapy hopes to fix, and the costs and access associated with gene therapy. It also jumps into a cosmetic arena when discussing which traits should be enhanced or “fixed” with gene therapy such as “height, intelligence, or athletic ability” (NIH). Long term side effects of gene therapy have not been studied in depth due to how new it is so there are unexpected risks associated with targeting embryonic cells. Therefore, in the United States, the government “does not allow federal funds to be used for research on germline gene therapy” (NIH). Organizations such as the NIH and FDA continue to limit and monitor the frontlines of research with cloning and gene therapy.

Strictly discussing full body human cloning has many ethical implications. Homosapiens have been naturally created since the beginning of their existence, and to conjure a fully formed one with cloned embryonic cells would result in consequences that can not be predicted. First off, humans are raised with cultural influences that give them their background, morals, virtues, dreams, passions, memories, and experiences. Creating a human that is already an adult would take those abstract experiences away and that human being would not be able to understand the societal aspects of life. Other ethical issues are that humans would not be able to know if the clone feels pain, can be destroyed, their life spans, and how they are mentally, emotionally, and physically defected by their created. Regulations that limit the research of human cloning are important because they also require scientists at the forefront of cloning research to be ethical in their actions and not create beings for immoral reasons.

In the United States, there are currently no federal laws outlawing cloning. Rather, the laws address the ethical rules regarding the funding towards cloning research. Different states do directly outlaw certain forms of cloning. These issues rose after the famous cloning of Dolly the Sheep and Congress created bills that outlawed human cloning to somatic cells, pursuing research that would allow a complete human to be cloned, and placing a cloned fetus into a woman’s uterus (The New Atlantis). Yet, due to the first amendment, there is no law that directly outlaws cloning. The German, Canadian, and Italian governments have directly outlawed cloning and have strict laws in place. The United Nations has been a strong voice in coercing member nations to create strong restrictions that limit the research of human cloning due to the ethical codes it would violate.

The Future of Cloning

“In addition to expanding the knowledge base in cellular, developmental, and molecular biology, as well as in cancer and aging, cloning has now been applied to enhance medicine and agriculture” (Berardino). Scientists are continuing to study the development of cells during meiosis and how somatic cells are differentiated. This research leads to the hope that mice, livestock, and endangered species will be able to be produced through cloning (Trounson). Creating “patient-specific embryonic stem cells” would continue to revolutionize the face of medicine because it would allow for unpredictable genetic diseases to be cured and the standard of life for human beings that would have otherwise had short life expectancies or had to live in pain to be increased.

This alone makes the research of cloning worth being continued because already it is helping the lives of so many people be bettered and creating ways to solve problems with animal endangerment that otherwise was not possible. In the future, ethical concerns remain regarding the reproduction of humans but the laws in place will limit unethical creations. Cloning will allow for skin cells that are damaged on a human being through accidents or illness can be replaced. If it is studied it will continue to create unique, genetically programmed cells that can cure diseases such as Parkinson’s or Cystic Fibrosis.

Bibliography

1. Ayala, F. (2015). Cloning Humans? Biological, ethical, and social considerations. Proceedings of the National Academy of Sciences of the United States of America. 112(29) doi: 10.1073/pnas.1501798112
2. About Cystic Fibrosis. (n.d.). Retrieved from https://www.cff.org/What-is-CF/About-Cystic-Fibrosis/
3. Cloning Fact Sheet. (2017, March 21). National Human Genome Institute. Retrieved from https://www.genome.gov/about-genomics/fact-sheets/Cloning-Fact-Sheet
4. Berardino, M. A. (n.d.). Cloning: Past, Present, and the Exciting Future. Retrieved from https://www.faseb.org/Portals/2/PDFs/opa/cloning.pdf
5. Burney TJ, Davies JC. Gene therapy for the treatment of cystic fibrosis. Appl Clin Genet. 2012;5:29–36. Published 2012 May 29. doi:10.2147/TACG.S8873
6. Friedmann, T. (1989). Progress toward human gene therapy. Science, 244(4910), 1275–1281. doi: 10.1126/science.2660259
7. How does gene therapy work? – Genetics Home Reference – NIH. U.S. National Library of Medicine (n.d.). Retrieved from https://ghr.nlm.nih.gov/primer/therapy/procedures
8. Lee, T. W. R., Matthews, D. A., & Blair, G. E. (2005). Novel molecular approaches to cystic fibrosis gene therapy. Biochemical Journal, 387(1), 1–15. doi: 10.1042/bj20041923
9. McCain J. (2005). The future of gene therapy. Biotechnology Healthcare, 2(3), 52–60.
10. McKinnell, G., R., Berardino, D., & A., M. (1999). Biology of Cloning: History and Rationale. BioScience 49(11) Retrieved from https://academic.oup.com/bioscience/article/49/11/875/220023
11. Mulligan, R. C. (1993, May 14). The basic science of gene therapy. 260(5110) Retrieved from https://science.sciencemag.org/content/260/5110/926
12. Part Four: Cloning Policy in the United States. (n.d.). Retrieved from https://www.thenewatlantis.com/publications/part-four-cloning-policy-in-the-united-states
13. Singh, D. (2004, February 28). Human cloning is justified in preventing genetic disease. 328(7438) Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1125280/
14. Trounson A.O. (2006) Future and Applications of Cloning. In: Verma P.J., Trounson A.O. (eds) Nuclear Transfer Protocols. Methods in Molecular Biology™, vol 348. Humana Press
15. Why Clone? (n.d.). Genetics Science Learning Center at the University of Utah. Retrieved from https://learn.genetics.utah.edu/content/cloning/whyclone/