Category: Cell

Viruses a foe which has affected the past and has now turned modern-day living into an almost apocalyptic like state due to the appearance of Covid-19. Along with being one of the most heavily studied areas within science, although a conclusive answer on whether viruses can be considered apart of the living or nonliving is still being debated. The virus does challenge the concept of what is considering living as a whole, due to the fact that it is considered vital to the web of life for various aspects (VILLARREAL, L. 2004). To properly grasp an understanding it’s essential to understand what a virus is and how it is structured. The basic virus consists of nucleic acid which acts as the genetic instructions for when the virus infects a host’s cells along with a protein coating which protects the DNA (genetic instructions). In terms of size and shape, they are smaller than a human cell around 20 to 400 nanometers to be exact, along with many different shapes. A virus thrives and survives by infecting the cells of other organisms and using them as hosts to initiate the process of replication. This is done by injecting the healthy cell with the genetic information present within the virus, in order to change what the infected cells produce. Once injected the now infected cell will begin to replicate the genetic material injected and form new viruses ready to be released throughout the organisms internal environment to infect more cells.

From a scientific perspective, on what grounds are viruses considered to be non-living? One can argue that since viruses require a host cell to reproduce therefore it is not classified as living it can not sustain itself. Furthermore for something to be classified as living it must meet certain set criteria that include the ability to maintain homeostasis, reproduce and grow, use energy along with respond to stimuli and have different levels of organisation. From the following list, viruses fall short in most of these aspects such as the use of energy, having different levels of organisation, ability to grow and they do not respond to stimuli and are not capable of independent replication rather having to rely on the mechanisms of the host cell to achieve replication (Brown, N., & Bhella, D. 2016). Viruses lack essential organelles as well such as the mitochondria which conducts the process of cellular respiration to provide energy. A virus also has no metabolism therefore It is not possible for it to use energy to synthesis itself (Northrop, J. 1958). This further supports the notion of viruses being non-living and not apart of living organisms.

On the other side, you also have the evidence and research that do claim that viruses are living and should be apart of the web of life. Darwin’s theory of survival of the fittest states that all organisms that do not adapt to the environment and selective pressures become extinct, though the non-living do not fall into this theory. Furthermore, if viruses were not living organisms the ability to adapt and change according to their environment they are faced with shouldn’t be possible (Hegde, N., Maddur, M., Kaveri, S., & Bayry, J. 2009). The most recent form of an evolved virus that is known to everyone around the world at the moment is currently Covid-19 the coronavirus, the coronavirus is nothing new and has always been around but this strand has evolved and adapted causing it to be currently incurable by vaccine at this point. This further supports that viruses easily adapt to their surroundings and evolve just like other living organisms can. Another example of why viruses would be considering living is simply the fact that as virus do rely on a host for survival and replication, although humans also rely on many different aspects to sustain their own life such as oxygen created from plant life. Also, a study conducted In 1992 revealed large amounts of genes which were thought only to exists within cellular organisms present within viruses (VILLARREAL, L. 2004).

Once all evidence and research are looked at, it becomes clear that there is more heavily supported evidence suggesting that viruses are to be considered non-living rather than living entities. Especially from the criteria point of view for living organisms which was created by scientists. Therefore it’s more-so acceptable to state that viruses are non-living due to the sheer amount of evidence and research that supports the non-living side of the debate. Conclusively more research is still being conducted and new supporting evidence for both ends are continuously emerging.

The rapid spread of severe acute respiratory syndrome (SARS) in early 2003 was accepted by a number of governments as a challenge to their national security because of its adverse effects on their economies, including their hospital systems.The SARS epidemic is one of the beneficial case study for evaluating national and international capabilities to deal with disease outbreaks, both naturally occurring and deliberate. This appendix examines the course, impact and important of the epidemic, including the lessons learned regarding the planning for and response to both naturally occurring and intentionally inflicted disease, describes the emergence of SARS and the international fight against it, with particular the role of the World Health Organization (WHO).

Section II of this appendix notes some unanswered questions about SARS, including the possibility of further outbreaks. Discusses the broader problems and costs entailed by such epidemics and the general case for better preparedness against them.Identifies some lessons from the SARS episode which may be useful in this context, covering global cooperation, preparedness planning and public information policy, discusses the possible use of SARS and other infectious diseases as biological weapons and the relevance of the BTWC. At last told about the conclusions.3

The role of the WHO and other organizations

The WHO International Health Regulations provide the legal background for global surveillance and reporting of infectious diseases and a mechanism by which measures to prevent the international spread of disease can be enforced. Possible further revisions of these regulations are being discussed at the WHO.

The novel nature of the SARS virus complicated efforts to contain the disease. Researchers had to identify and characterize the causative agent in order to be able to develop a diagnostic test, treatment protocols and a scientifically sound basis for recommending control measures.

WHO have given the instructions to Stop the spread of SARS by isolating infected individuals and those who had been in contact with them initially offered the only hope of containing and eliminating the virus. Controlling people’s motion and providing facilities and hospitals are difficult in any country, and this is very accurate for economically unstable countries. Separating the victims of SARS and their contacts nevertheless provided the most effective means of control. The WHO information circulars and travel advisories also mainly assisted in the control of the disease. conformation the onset of a disease in a very early step is a necessary by creating a vaccine and establishing and adopting diagnostic methods and techniques. In experiments conducted at Erasmus University in Rotterdam, the Netherlands, scientists infected monkeys with the coronavirus that is suspected of causing SARS, and which was first separating by Hong Kong University on 27 March 2003. On 16 April, within a month of its establishment, the laboratory staffs announced conclusive identification of the SARS causative agent: a new coronavirus, unlike any other known human or animal virus in its family. The test animals developed the same symptoms of the disease as those developed by humans, and this confirmed the identity of the virus that causes SARS. In May 2003, scientists announced the first results of studies on the life span of the SARS virus in different environmental conditions and in various bodily specimens, including feces, respiratory secretions and urine.

Scientists at Canada’s British Columbia Cancer Agency’s Genome Sciences Centre fulfilled sequencing of the genome of the SARS virus in time duration of one week on 12 April 2003. This help in diagnosis, which was previously done by the process of elimination, Speedy diagnosis and the genome map will assist in providing the basis for identifying possible mutations.

Daily teleconferences of epidemiologists, including WHO team members, from major outbreak disease led to refined case definitions, facilitated daily reporting, exact modes of transmission, tracked exported cases and highly increased the understanding of the control measures that worked best in various country.

The WHO also sent teams of epidemiologists and other specialists to explore environmental sources of infection and to discuss with authorities about the conditions by which the initial reports of SARS might have emerged.

The first international consultative meeting on the global epidemiology of SARS provide a comprehensive document on the status of current knowledge to give strong policy recommendations to restrain and control. Participants of the debate described the clinical course of SARS, compared and contrast different treatments results, recommended guidelines for isolation and infection control, and investigate possible ways for the rapid recovery of many patients and the rapid damage of others as well as for the very small number of pediatric cases. The experience got from the SARS epidemic has demonstrated that, with strong global leadership, scientific experts from the whole world can work in an effective collaborative manner to identify and contain novel pathogens. The WHO arranged broadly restrain campaign that prevented SARS from becoming a widely threat. The scientific priorities contain the development of a reliable diagnostic test, improved understanding of the modes of transmission and identification of effective treatment regimes. The influenza network was used as a model for the SARS laboratory system, suggesting that such an approach contributes with highly rapid as well as efficiency.

Chart of seasonality of respiratory virus infection in mild areas. Respirational viruses are categorized in three groups according to their seasonal epidemics.Influenzavirus, human coronavirus (HCoV) (such as strains OC43,HKU1,229E,and NL63),and human respiratory syncytial virus (RSV) show peaks in winter (winter viruses).Adenovirus, humanbocavirus (HBoV),parainfluenza virus (PIV),human metapneumovirus (hMPV),and rhinovirus can be detected throughout the year (all-year viruses).Seasonal patterns of PIV are type specific. Epidemics of PIV type 1 (PIV1) and PIV type 3 (PIV3) peak in the fall and spring-summer,respectively.The prevalence of some non-rhinovirus enteroviruses increases in summer (summer viruses).

In other Study viral agent divide in to three groups Based on their similarity and seasonality. Enveloped viruses, Non enveloped viruses and Enveloped viruses with preference for warmer temperatures.

Non enveloped viruses; Rhinovirus and adenovirus Which are present all of the year. Enveloped viruses with winter majority (RSV,HMPV,IAV, and IBV).

Generalized Rectilinear Models. Thegeneralized linear models were made to prove the seasonality of each virus. Using temperature as a evaluation meteorological reason, the maximum point in the waveform for each virus is the time of year where they are most active in the population .Enveloped viruses in the winter. RSV – 17th of December, IAV – 12th of January, IBV – 8th of February; HMPV – 11th of March 4b: Non-enveloped viruses. Adenovirus – 5th of March, Rhinovirus – 6th of November; 4c: Human parainfluenza viruses. HPIV-1–31st of October, HPIV-2–15th of November, HPIV-3–4th of May.Inthis study, non-enveloped agents are existing year-round with some seasonal difference. Adenovirus is identified to be stable at high humidity levels (80%). Since this is very close to the mean humidity for the study period (81%), this could explain the presence of adenovirus throughout the year. Davis GW showed that adenovirus survival is better at elevated humidity levels (89%) than at lesser humidity (50%)20. The peak in March originate in our GLM for adenoviruses is different to the December peaks observed for enteric adenoviruses in Japan, though a peak in the winter months is got when GLM was drawn for 2011, a year when visual peaks for all viruses were present. Our results show that adenoviruses prefer temperatures around 9 °C. The inverse relationship among adenoviruses and temperature, documented by the minor OR, is in keeping with the report from Germany.

References

1. Chang W. L., Yeung K. H., Leung Y. K. Climate, Severe Acute Respiratory Syndrome (SARS) and Avian Flu. WMO Bull. 2005;54(4):1-9.
2. WHO Scientific Research Advisory Committee on Severe Acute Respiratory Syndrome (SARS). 2003;(October).
3. Who. WHO Scientific Research Advisory Committee on Severe Acute Respiratory Syndrome (SARS). October. 2003;(October). http://www.google.com/url?sa=t&source=web&cd=2&ved=0CCIQFjAB&url=http%3A%2F%2Fwww.who.int%2Fcsr%2Fresources%2Fpublications%2Fen%2FSRAC-CDSCSRGAR2004_16.pdf&ei=NyEvTdruMpDQjAfv_pyEBQ&usg=AFQjCNGopYJ5jogaXwsTLtiRoog1vHiENA.
4. Bulletin WMO. Reprint 611 Climate , Severe Acute Respiratory Syndrome ( SARS ) and Avian Flu W . L . Chang , K . H . Yeung & Y . K . Leung. 2005;54(4).
5. Price RHM, Graham C, Ramalingam S. Association between viral seasonality and meteorological factors. Sci Rep. 2019;9(1):1-11. doi:10.1038/s41598-018-37481-y

Introduction

Hello members of the editorial board, today I present to you a journal article called the ‘Mathematical Model for Cell Division’ by D. McKenney and J. A. Nickel. This article has caught my eye because it is easy to read and understand with some background knowledge. The journal article is constructed in a way that guides the reader step by step on their topic of cell division and its mathematical model. I am presenting this article in the hopes that the editorial board will see its unique structure and add it to the new iteration of the Special Volume on Effective Writing.

Before I present the mathematical model in the article, I would like to quickly give a brief explanation on what the model is based on. Cassini’s ovals are the basis of the journal article and the authors assume that cells before dividing are elliptical in shape and have constant total volume. Cassini’s ovals also states that at a locus, the product of two points will remain constant.

Modelling Process

Problem Statement: The ‘Mathematical Model for Cell Division’ focuses on the latter two stages of the cell division process: anaphase and telophase. During anaphase and telophase, chromatids in the cell will separate in opposite directions causing it to form an elliptical shape before separating into two daughter cells. It is also important to note that by using Cassini’s ovals, there are two points which represent the two center points of the nucleus as the cell divides. Based on this information, D. McKenney and J. A. Nickel were able to derive a formula presented above where they can find the volume of the daughter cells after splitting.

Assumptions: During the process of deriving the formula for volume, the authors assumed that the total volume remained constant throughout the process of mitosis (anaphase and telophase), as during the process the loss of potential cell matter that affects cell volume was negligible. It is also assumed that the shape of the cells that divide is ellipsoidal so that its volume can be calculated.

Defining Variables: In the equation, there are two variables that determine the overall volume of the cell. k2is defined as the ratio of the product of the distance of the two loci divided by the square of the half distance between the two loci. The location of the two points are in a scaling parameter to ensure that the points produce a constant volume during calculations. The other variable a, represents the parameter and its scaling factor.

Applying The Mathematical Model

Given the chart from the article, we can apply it and essentially calculate the volume of the cell. Where the parameter is 2 and the scale is 1 respectively, if you plot it in a graph as a function of scaling factor vs. shape parameter to get the value of k. Once k is determined, and if you determine whether the value of k is between 0 and 1 or if it is greater than 1, then the equation can be used to calculate the volume of the cell.

Conclusion/Discussion

The ‘Mathematical Model of Cell Division’ is an organized and well written article that is precise and clear about it’s modelling process and serves as a good example of what an article journal should look like. Although I did not understand what the Cassini’s ovals were, it did a good job explaining it in the context of calculating the total volume of cells during mitosis. It serves as a basis for future calculations regarding cell division and volume assuming the cell is elliptical. All in all, it would serve as an excellent addition to the upcoming Special Volume on Effective Writing, as it’s mathematical model makes it easy for readers to understand and apply it to their own research and writing.

Citations

1. McKenny, D., and J. A. Nickel . Mathematical Model For Cell Division. Mathematical and Computer Modelling , Jan. 1997, www.sciencedirect.com/science/article/pii/S0895717797000058.

Viral respiratory infections can cause many different illnesses related to the respiratory tract. These diseases may range from mild infections to more severe ones that can even lead to death. The most common respiratory disease is known as a cold, which is a mild infection that affects the upper respiratory tract and it is harmless in most cases. Common colds can be caused by many different types of viruses, the most frequent ones being rhinoviruses. Viral pneumonia, in the other hand, is an example of a lower respiratory tract infection, mainly caused by influenza viruses, in which the tissues in the lungs get inflamed and fluid enters the air sacs – this leads to shortness of breath, an excruciating pain in the chest, chills, etc. For people that are older than 65 years old, toddlers, smokers or immunocompromised people the risks of pneumonia being a life-threatening disease are very high (Medical Microbiology 1996). According to Public Health England, influenza A and B, respiratory syncytial virus, rhinovirus, parainfluenza and adenovirus are the most common types of respiratory viruses in England and Wales (Public Health England 2018).

Humans are mostly affected by influenza A and B during winter season. In most cases they have to be hospitalized and sometimes it can be fatal. (Stanford Children’s Health n.d.). These viruses are mainly transmitted via aerosols, through a sneeze per example, or by getting in contact with an object or food that had previously been touched by an infected person (Cowling, Fang, Olsen et al. 2014). Human rhinovirus (HRV) is often related to infections in the upper respiratory tract and are often treated with antiviral drugs, but recent tests, such as PCR assays, show HRV to also be the cause to many pulmonary diseases in children, elderly and immunocompromised adults, which is similar to the effects of the influenza viruses (Jacobs, Lamson and Walsh 2013). Respiratory syncytial virus mostly relates to infections in the lower respiratory tract in infants that might later develop bronchiolitis and will need to be hospitalized. In all of these cases, the person might be infected more than once by the same virus. Mutations in these microorganisms cause the antibodies to not recognize them when they enter the body and so, infection will occur again (Meng, Stobart, Hotard, et al. 2014).

One of the long-term solutions to prevent viruses are vaccines. These are made of the dead microbe and its surface proteins. When inserted into the body, there will be an immune response to this agent, which will cause the immune system to recognize the virus in the future and destroy it. (Ahmed and Orenstein 2017)

There are many different techniques performed for the diagnosis of viral diseases, such as cell culture/viral culture, ELISA, RT-PCR or simply PCR. One of the main advantages of viral cultures, is that they allow the identification of many different viruses at the same time, which can also include viruses that were not expected to be present when the culture was made. On the other hand, not every virus grows in the same environment, so more than one culture must be designed to allow cell growth and it can be time consuming (Storch 2000). The Enzyme-Linked Immunosorbent Assay (ELISA) is a quick test that is either used to detect agents that are strange to the organism – antigen ELISA – or to detect the antibodies released as a response to an infectious agent – antibody ELISA. These will show if the person had previously been in contact with a certain virus or if they are infected at that time (Thermo Fisher Scientific n.d.).

Real-Time PCR was the technique used in this project for the identification of viruses. This method is quick, highly sensitive, and the risks of contamination are low. It uses pairs of primers that hybridize to each strand of the DNA molecule. Taq polymerase then creates a complementary strand for the hybridized primer. The reaction goes through different cycles with different temperatures and many copies from the initial DNA sequence of interest are produced (Mackay, Arden and Nitsche 2002).

The aim of this experiment was to identify what viruses were present in different unknown samples by using BLAST to design primers, PCR to clone the DNA molecules and gel electrophoresis to observe the results.

Methods

To identify what virus was present in each sample, the following steps had to be taken.

Purification of viral RNA

Cells were broken down by centrifugation and RNA was extracted. By using the QIAmp Viral RNA Mini Kit, the viral RNA was purified. This process was carried out according to the protocol in the QIAmp Viral RNA Mini Handbook, in pages 27-30, although 100 μL of the sample was used instead of 140 μL and the concentration of ethanol was 100%. A nanodrop test was made to determine if RNA was present.

Preparation of cDNA

To synthesize the cDNA from the viral RNA that was previously extracted, the guide provided by Tetro cDNA Synthesis Kit Protocol was followed. With this, two samples for each unknown virus were prepared and the enzyme reverse transcriptase was added to one sample of each virus. Therefore, there was one sample with the enzyme and one sample without it for each virus.

These were then incubated for 10 minutes at 250C and for 30 minutes at 450C, to allow the reaction to run. After that, these were incubated at 850C for 5 minutes to stop reaction and the samples were incubated at -200C for long term storage.

Primers

The following forward and reverse primers were designed using BLAST for each virus so it would be possible to produce bands with different sizes:

• Influenza A forward primer – GAGATGTGCCACAGCACACAAA
• Influenza A reverse primer – GACCAACACTGATTCAGGACC
• Influenza B forward primer – CAAGGGAATACAACTTAAAAC
• Influenza B reverse primer – GCTTCATCTGGGGGCATTTC
• RSV forward primer – GCGGATTCAATAATGTTATC
• RSV reverse primer – GGATAAGTGTTTAGTTTATAG
• Rhinovirus forward primer – CATCCCAGTGTATTTTATGATG
• Rhinovirus reverse primer – CCTTAATATATGTAACTAGAG

Preparation for PCR

For positive controls, 4 samples were produced, one for each known virus. In these, 0.4 μM of cDNA was added with a total of 3.4 μM of primers and 15 μL of master mix.

A separate sample containing water was used as negative control.

To another Eppendorf tube, 2 μL from the unknown cDNA that was previously prepared was added – 0.4 μM – together with 1μL of each primer – which totals a concentration of 3.4 μM – and 15μL of master mix. This master mix was made by technicians and it contains dNTPs, Taq Polymerase, buffer, primers and water. Thus, there was a total of 4 Eppendorfs with the unknown samples, in which two were treated with RT and two were not.

PCR

PCR was performed using the following cycling conditions: 94°C for 30sec, 30 cycles of 95°C for 30 sec, 50°C for 30sec, 72°C for 60 sec followed by 72°C for 10min, and it was held at 4°C.

Gel electrophoresis

The gel used for the electrophoresis was the 2% agarose gel. After this had set, 50 ml of TBE buffer was poured into the tank. Then, 1 μL of bromophenol blue dye and 5 μL of every sample were added to the wells and the gel was run for 30 minutes at 100 volts.

Identifying the bands

For the viruses’ sizes to be identified, the gel was radiated with UV light in a machine which cause the fluorescence of the bands. A picture was taken, and the results were observed.

Results

To find out which viruses were in both samples 1 and 3, primers had to be designed. The accession codes provided to the students were used in both nucleotide and primer BLAST and the most appropriate primer was selected. The forward primer was then located in the nucleotide sequence and the results were screenshotted. The reverse primers were firstly translated into their reverse complement and then aligned to the nucleotide sequence.

Discussion

For PCR to be performed, the single-stranded RNA had to be extracted and purified to then be transcribed into complementary DNA. Both extraction and purification had to be carefully carried out to avoid any external contaminations, which would lead to the expression of the wrong genes when replicating (Burke 2018).

The nanodrop provided the value for the RNA concentration. Even though the concentration for sample 1 was low, it still shows the presence of that molecule, which means the experiment could be carried on. As mentioned before, the primers designed for this experiment were not the ones used and this explains why the size of the bands shown in figure 2 are different from what had been initially planned. Each primer was chosen according to the optimum temperature and size length of the sequence.

There were two ways the samples could have been prepared for PCR: either adding all the primers to the same tube or test each sample alone with each primer. They both lead to the same results, but it is less time consuming if the primers are all in the same Eppendorf – primers anneal to different sequences of the DNA, and so, they will only bind to their specific complementary virus, consequently producing different sized fragments (Khan Academy n.d.).

As it can be seen in figure 2, the known viruses were in wells 1, 2, 5 and 6. In the 3rd well, water was added, and it acted as negative control since there was no cDNA to it. This proves that the gel electrophoresis worked. No bands were formed for samples 1 and 3 without reverse transcriptase, which was already expected. PCR cannot amplify RNA molecules. Because the enzyme reverse transcriptase was not added to these samples, cDNA was not formed. Therefore, they could not be amplified in PCR and, as a result, no fragments were formed in the gel electrophoresis. – these samples can also act as negative controls. The bands presented at the bottom are the primers used. In an ideal situation, these bands would have been eliminated. For this to be improved, there could be an increase in the cycling parameters and change to the temperatures so it could be optimized (Roux 2009). Also, the fact that some bands are more faded than others can show signs of contaminations in the sample.

Another error was not adding loading dye to the DNA ladder; therefore, it was not possible to observe any results from wells 4 and 8. Without any DNA ladder to compare the size of the bands to, assumptions on the sizes had to be made. The DNA is negatively charged and so it is “pulled” to the positive side of the gel when the machine is on. The smallest negatively charged fragments move faster than the biggest ones (Lee, Costumbrado, Kim 2012) and, when taking that into consideration, it can be estimated that sample 1 was Influenza A and sample 3 was influenza B.

This experiment allowed the students to find out more about this virology field, where viruses are diagnosed, identified and “fought” against. Viral respiratory diseases have a great impact every year in the UK population but, fortunately, the techniques used for diagnosis and treatment are constantly becoming more efficient to avoid the spread of malignant viruses.

References

1. Ahmed, R., Orenstein, W. (2017) Simply put: Vaccination saves lives [online] 114 (16) 4031-4033. available from [28 March 2019]
2. Burke, B. (2018) 216BMS Cloning Lab Schedule 2018-19. Unpublished booklet. Coventry: Coventry University [1 April 2019]
3. Cowling, B., Fang, J., Olsen, S., et al. (2014) Modes of transmission of influenza B virus in households. [online] 9 (9) n.a. available from [27 March 2019]
4. Dasaraju, P. Liu, C. et al (1996) Medical Microbiology [online] 4th edn. Texas: Samuel Baron. available from [27 March 2019]
5. Jacobs, S., Lamson, D., Walsh, T., et al. (2013) Human Rhinoviruses [online] 26 (1) 135- 162. available from
6. [27 March 2019]
7. Khan Academy (n.d.) Polymerase Chain Reaction (PCR) [online] available from [1 April 2019]
8. Lee, P., Costumbrado, J., Kim, Y., et al. (2012) Agarose Gel Electrophoresis for the Separation of DNA Fragments [online] (62) 3923. available from [2 April 2019]
9. Mackay, I., Arden, K., Nitsche, A. (2002) Real-time PCR in virology [online] 30 (6) 1292- 1305. available from < https://www.ncbi.nlm.nih.gov/pmc/articles/PMC101343/> [31 March 2019]
10. Meng, J., Stobart, C., Hotard, A., et al. (2014) An Overview of Respiratory Syncytial Virus [online] 10 (4) n.a. available from [27 March 2019]
11. Public Health England (2018) Six major respiratory viruses reported from PHE and NHS laboratories (SGSS) in England and Wales between weeks 01/2008 and 41/2018 [online] available from [27 March 2019]
12. Roux, H. (2009) Optimization and troubleshooting in PCR. [online] available from
13. Stanford Children’s Health (n.d.) Influenza (Flu) in Children [online] available from [27 March 2019]
14. Storch, G. (2000) Clinical Infectious Diseases [online] 31 (3) 739-751. available from [28 March 2019]
15. Thermo Fisher Scientific (n.d.) Overview of ELISA [online] available from [28 March 2019]

Biology has been playing a very big role in our society since the ancient times until now. As one of the branches of science assigned in studying life and living things, it allows us to discover and learn about different organisms through testing, reviewing and experimenting using scientific research methods. Biology allows us to learn about the structure, function, behavior and relationships of living things. Fundamentals of Biology starts from the basic concepts which lets us to deeper understand the connection of each specie and how they work today in the world we are existing in. It enables us to ask questions and answer them through scientific investigation. It gives us idea on where and how life began. Biology continuously provides vital information about the existence of living organisms on Earth.

Through the years, we have encountered various biological issues and problems we are able to find solutions to, through the use of Biology. Like how Dr. Edward Jenner was able to find a vaccine in 1980 to smallpox; an infectious disease that has infected and killed people for a thousand years, Louis Pasteur, known as the Father of bacteriology also used science to perform various experimentations to immunization. A lot more viruses such as Poliomyetelis (polio), Ebola virus and HIV has become less threatening because of the vaccines that were researched and formulated.

In December 2019, the first case of Coronavirus has been detected in Hubei Province, China. Affected people rapidly increased all over Wuhan and then invaded countries all over the world. Coronaviruses are a group of viruses that can be transmitted between animals and people, causing illnesses that may range from the common cold to more severe respiratory syndromes. In February 2020, the International Committee on Taxonomy of Viruses and the World Health Organization announced official names for both the virus and the disease it causes: SARS-CoV-2 and COVID-19, respectively. The name of the disease is derived from the words- corona, virus, and disease, while the number 19 represents the year that it emerged.

This pandemic shook the whole world into panic because of the it’s very sudden begin that put everyone’s lives to danger. As of now, there is still not much information about the certain virus. There is still no news of how it all began and how to get rid of this virus. Currently, almost 3.3 million cases have been discovered all over the world with 8,488 cases in the Philippines alone. Public is having anxiety attacks as governments announce lockdown in every country as the initial action in order to prevent virus from growing bigger.

March 13, 2020, Philippine President Rodrigo Roa Duterte has announced that lockdown of Manila because of the first case detected in the country. Zambales and other provinces also locked the areas down in order to take precautions on the said dilemma. It has almost been three months since it happened and people are growing more afraid because of the non-existent vaccine and the growing number of deaths and affected people as of now. However, I have observed that not everyone believes the existence of this virus until now. Other people say that they are only “fiction stories” made by the government in order to take full authority over the mass. I believe this is because there is no detailed information about this virus have been told to the public yet. Information such as the symptoms, transmission, prevention and primary precautions are the only thing people know which brings fear into everyone but no understanding of what is really happening. This pandemic not only brought health problem to the world but also brought life-sacrifices, poverty, hunger, fear and anxiety into the situation.

Fortunately, the world is slowly healing. There has been cases of recoveries and that news brought light into the eyes of everyone. Number of recoveries has been greatly increasing as well, and doctors and scientists are also starting to find out more background of COVID-19. There are now number of possible cures that can be used for this disease. Virology can be used to learn the behavior of these viruses. Human Biology can be used to understand how diseases or infections affect the functionality of the body, the parts of the body mainly affected by it and where in the body should be improved in order to prevent diseases from hitting us. Epidemiology is the study of diseases in a given population and examine where and how diseases are transmitted from one person to another and how to effectively treat them. By experimenting, researching, and technology, we gather more learnings and idea and improve them bit by bit in order to formulate the best cure in different types of biological issues including the novel coronavirus or which is known as COVID-19 pandemic.

Whenever there is something that we do not understand, we start to come up with assumptions and feel very curious about them which is why Biology exists in the first place, however as we learn something, we start asking more questions but we gain clarity and understanding into them as we dig deeper.

We define Science as a catalogue of observations or list of information to understand the world around us and a systematic way of explaining a wide range of phenomena in the simplest possible manner which also proves that Biology, being another branch of Science is a very huge answer to solve the pandemic we are currently experiencing. Biology covers all the living organisms in the Earth therefore we are able to learn about them through learning and using all the concepts of it that supports each other. Overall, with the help of Biology, we are able to rise questions and find answers by studying every variable in the problem, come up with ideas until we arrive to the closest possible answers to problem we are seeking to know while crossing out the assumptions we had and gaining more knowledge to everything we want to find answers to, meticulously and start another discovery that will benefit everyone in the long run. Sooner or later, as we continue to study the phenomena, we will be able to find the perfect vaccine for this COVID-19 and drive the fears of people as Biology plays the biggest role in this.

The qualifications all biotic beings meet are not met by viruses on the grounds that there is a lot that a virus is unable to do. A virion cannot maintain homeostasis, or regulate its internal processes because it does not have the anatomy to do so, simply because a virus is not made up of cells. A virion is, fundamentally, genetic material trapped in a protein casing. It cannot grow because when it is duplicated in a cell it is exploiting, it comes out as the state it will always be in. Additionally, they have not been found to react to stimuli because they rely on a host so that it may replicate its genetic material. When isolated, viruses do not respond to anything, meaning that a virus needs a host to perform any functions. As a result of all of this, it can be strongly argued that viruses are abiotic.

Despite all of the things a virus cannot do, a virus can evolve. One of the most familiar viruses to exist is the infamous influenza. Biologists have recognized copious strains exist because the commonly appearing winter virus can and does modify itself a handful of times annually. This occurrence results in the yearly vaccine many people get for influenza mostly ineffective. The adaptations a virus undergoes is the central reason why many argue that they are living.

Reproduction and management of energy are two operations that might be included in the ability of viruses based off of how loosely one would like to define both processes. A recurring point in the assertion viruses to be known as non-living is their reliance on actual cells to fulfill their purpose. It is true that a virion replicates its genes to pass off to offspring; however, every virus is needing a cell to do just that. It is neither asexual nor sexual, and as a consequence cannot be indexed as reproduction. There is energy is used when a virus completes the course of replicating its genes. Yet again, the energy has not been found to be originating from the virion, but the actual organism. Viruses are entirely contingent on hosts to function as viruses do.

Six common components are shared wall to wall by all organisms. As it is known today, scientists have recorded adaptations in viruses. Viruses technically cannot and does not attain and handle energy, reproduce, mature or develop, rectify internal operations, and be found in cells. Due to the many reasons that scientists have argued for viruses never retaining life, it can be reasonably deduced that this case is true.

In my opinion I don’t necessarily believe viruses are alive because of the fact that viruses can’t reproduce on there own, they need a cell to reproduce. If you had a looser definition of alive then maybe they can be considered alive. I also beileve there not alive because according to the seven characteristics of life for something to be considered alive it has to be able to grow over time, respond to stimuli, metabolize energy, produce offspring, maintain a stable body temperature, adapt to their environment, and consist of one or more cells. Living things grow use nutrients and energy to grow.

Viruses exploit there host into building viruses, therefore each virion is created fully grown, and it will not get bigger or intricate. Meaning viruses can’t grow. Viruses haven’t really shown that they can respond to stimuli, but there also isn’t enough research to be one-hundred percent sure. For a virus to create another virion unit it has to build nucleic acids, to be able to put capsids together, and this does take a lot of energy. But, all this energy that goes into creating this comes form the host. Viruses can benefit from energy, but there taking it from the host. Therefore technically it’s a maybe as to whether they use energy. Viruses multiply, and while our immune system can handle one virion, it can harm us if there are thousands, and if they are replicated in a short period of time.

Viruses need to use the host’s cells to create virions. Because of the fact that they don’t have nuclei, ribosomes or organelles, so they don’t have the resources to copy their own genes. Therefor they seize the ‘host’s cellular equipment, to copy there viral genetic information, build capsids, and construct everything.'(According to https://rb.gy/k5niwk) Therefore I believe it’s considered replicating instead of reproducing. Viruses can’t maintain homeostasis because of the simple fact that there not made up of cells and to maintain homeostasis they need cells to do this. Also viruses don’t have cell membranes so they can’t help maintain homeostasis.

Evolution, and adaptations happen through mutations, and viruses do adapt to their surroundings. Unlike responding to Stimuli adaptation can take place over time. A virus lives in one of two stages the Lysogenic phase, and the Lytic phase. In the Lysogenic phase the viral DNA integrates itself within the cells DNA and it then multiples, whenever the cell multiplies. In the Lytic phase the virus is fervently replicating itself into the host’s cells. If a host doesn’t have enough energy to support the viruses’ replication process it will switch to the lysogenic phase. So it technically can adapt to it’s environment if it’s unstable. Living things are made up of cells, but viruses aren’t made up of cells. Viruses are made up of virions, capsids, and an envelope, but not cells. So, in this case there dead. This is as to why it is believed that viruses aren’t alive if anything they can be described as androids.

References

1. https://link.springer.com/article/10.1007/s11084-010-9194-1
2. https://www.livescience.com/58018-are-viruses-alive.html#:~:text=According%20to%20the%20seven%20characteristics,and%20adapt%20to%20their%20environment.
3. https://www.khanacademy.org/test-prep/mcat/cells/viruses/a/are-viruses-dead-or-alive

Introduction

Mantle cell lymphoma, previously known as diffuse small cleaved cell lymphoma and centrocytic lymphoma , is a low-grade non-Hodgkin lymphoma. It is a mature B cell neoplasm, consisting of mature B cells which have exited the bone marrow. Traditionally, MCL is known to be a very aggressive NHL despite its low-grade nature, and is considered to be incurable with current therapies. It typically afflicts the older population, with the median age of presentation of patients ranging from 60-68 . MCL has shown a clear male predisposition as well, with the male-to-female ratio of 3:1 . It is a rare lymphoma, which accounts for 8% of all NHL . Racially, it has a higher incidence in Caucasians than African Americans and Asians .

Pathogenesis

The initiating oncogenic mutation for MCL would be t(11,14)(q13;32), which concerns the oncogene bcl-1 on 11q13 and the immunoglobulin heavy chain gene on 14q32. Bcl-1 encodes for cyclin D1, a cell cycle protein regulating the progression of the cell from G1 phase to S phase . The translocation juxtaposes the bcl-1 gene next to the immunoglobulin heavy chain gene, which is highly active in mature B cells. This results in the overexpression of cyclin D1 in MCL cells, leading to disrupted cell cycle entry. It should be noted that t(11,14)(q13;32) itself alone does not have full oncogenic potential; oncogenicity is acquired through the gaining of additional genetic lesions and increased genomic instability. The WHO 2016 Classification has delineated 2 subtypes of MCL based on the clinical presentation and the cell of origin of the malignant clone, which in turn is differentiated by the expression status of the transcription factor Sex Determining Region Y-Box 11 (SOX11) . In classical MCL (cMCL), a more aggressive clinical course with general lymphadenopathy is common. De novo SOX11 expression is noted, which prevents virginal B cells from entering the germinal centre and participating in GC reactions. cMCL cells therefore have minimal IGHV mutation and are naïve-like as they have not experienced GC events. In contrast, the non-nodal subtype of MCL (nnMCL) has a more indolent course, and their presentation is leukaemic rather than with strong lymph node involvements. Splenomegaly is also common. SOX11 negativity allows the nnMCL cells to experience germinal centre reactions, with the resultant cells having a higher number of IGHV mutations resembling memory B cells. nnMCL cells also have a more stable karyotype and further progression into more malignant variants is less likely than cMCL . nnMCL accounts for about 10-20% of all MCL cases .

Morphology

Histologically, MCL consists of small to medium sized lymphoid cells with irregular nuclei . Chromatin is condensed with inconspicuous nucleoli, hence its low-grade classification. Large cells are uncommon . Cytologically, variants of MCL include classic, small cell, blastoid and pleomorphic. Cytological variations of MCL is associated with disease severity and survival, with blastoid and pleomorphic variants having a worse prognosis . Blastoid MCL has a higher genomic instability with of additional mutations, such as tumour suppressor gene TP53 . It should be noted that blastoid transformation can occur from milder cytological variants through the gaining of additional genetic lesions, or from other haematological malignancies including chronic lymphocytic leukaemia (CLL), though the molecular events leading to such transformation is distinctive process known as MCL-variant Richter transformation. Lymph node involvements in MCL can be classified as distinctive patterns, namely mantle zone, nodular and diffuse by the extent of germinal centre disruption .

Immunocytochemistry

Upon staining, the neoplastic cells show positive staining for pan-B antigens, including CD19, CD20, CD22 with surface immunoglobulins IgM and IgD, in line with its B cell nature. Aberrant positivity of CD5, a T cell marker, is noted. Staining with cyclin D1 and cyclin D1/BCL1 is positive. Rare presentations of cyclin D1-negative MCL may yield negative cyclin D1, but positive stain on cyclin D2 or D3 . Negative stains include CD10 and 23, with the latter differentiating MCL from small lymphocytic lymphoma .

Patient presentation

Most patients present with late stage MCL, with 70% presenting with stage IV disease. Generalized, extensive lymphadenopathy and splenomegaly are common findings. A high proportion of patients also presents with extranodal involvements, with lymphoma cells spreading to mucosa-associated lymphatic tissues such as Waldeyer’s ring. GI involvement is also common, which mainly manifests in stomach and colon. Occasionally, incidental cases of lymphomatous polyposis are discovered when the patient undergoes colonoscopy . Bone marrow involvement is also extremely common. Leukaemic presentation can also be found in patients with nnMCL, or in late-stage patients with MCL cells spillover to peripheral blood. Pancytopenia may be observed if marrow failure occurs due to extensive bone marrow involvement. B symptoms, the triad of unintentional weight loss, night sweat and fever, may also be reported by the patient.

Treatment

Treatment for MCL remains diversified, but chemotherapy remains the mainstay of treatment. Considerations for regimens include patient age and risk stratification. The Mantle cell International Prognostic Index (MIPI), devised by the European MCL Network, is commonly used for the formulation of risk-adapted therapy. MIPI identifies patient age, Eastern Oncology Group (ECOG) Performance Status, LDH status and WBC count as independent prognostic factors that impact patient survival, and stratifies the patient pool into 3 categories: MIPI low-risk, MIPI median-risk and MIPI-high risk. The recent incorporation of proliferative index Ki67 takes into account of the proliferative activity of the neoplastic cells in vivo, and further improves the prognostic accuracy of MIPI as biological MIPI (bMIPI) . A higher proliferative index (>20%) is associated with a worse prognosis. For asymptomatic patients with an indolent disease presentation, or in the low-risk group, an observational approach should be adopted to avoid the initial use of aggressive therapy. Clinical interventions should be adopted when the patient progresses. For these patients, a commonly used regimen would be cyclophosphamide, hydroxydaunorubicin, vincristine and prednisone. An anti-CD20 monoclonal antibody, most commonly rituximab, can also be added (RCHOP). RCHOP combination therapy yields a satisfactory overall response rate as high as 96%, with a complete remission (CR) of 48% . For elderly patients, a milder approach should be considered in the view of cardiac toxicities of anthracycline-containing regimens and slower marrow recovery. Rituxumab-bendamustine (RB) is commonly used due to the less severe side effects of bendamustine, such as haematological toxicities and alopecia . Although less agents are used in the RB regimen when compared with RCHOP, it is shown that the efficacy of RB is similar to RCHOP, reaching an ORR of 89% . Other alkylating agents such as chlorambucil, and the purine analogue fludarabine are shown to be effective against MCL as well. For patients with a high tumour burden or patients in a palliative settting, hydroxyurea can be given for cytoreduction. For younger patients, an aggressive therapeutic approach should be considered to establish CR. R-HyperCVAD alternating with high dose cytarabine and methotrexate, or other similar modified regimens including Nordic Protocol, is considered the treatment of choice. However, severe haematological toxicity may lead to marrow suppression, and make marrow recovery difficult. It is shown that stem cell transplantation, including autologous and allogenic HSCT, improves survival outcomes . Younger patients that can tolerate total body irradiation and myeloablative conditioning should considered HSCT for consolidation.

Despite promising statistics is shown for different first line treatments of MCL, a high proportion of patients will stop responding to treatment and progress. A collection of studies has shown that the progression free survival (PFS) is 7-20 months, with the longest study reported 26 months. Relapse after attaining CR is extremely common as well.10-year OS for MCL is reported to be as low as 5-10% . Curative therapies for MCL remains lacking and more research is needed to develop novel agents. However, with respect to the latest researches concerning mantle cell lymphoma, both epidemiological and therapeutic research seems to be heavily biased towards Western Caucasian population. In particular, epidemiological information on Asian patients, especially Chinese, are lacking, with only 1 paper by Chim et al. providing details on the epidemiological features of Chinese MCL patients. Constructing an accurate epidemiological background on Chinese patients is paramount to provide a better picture for further clinical research. Therefore, the clinical and epidemiological data of MCL patients processed at Queen Mary Hospital (QMH)is organized and presented in this paper.

Patients

Due to administrative constraints between different hospital clusters, only patients with MCL who has been under the care of QMH at any point of their disease course were considered for the study. Biopsy records with a diagnosis of MCL established or confirmed by the Department of Pathology of Queen Mary Hospital during the period of 2003-2018 were recovered. A total of 83 biopsy records were reviewed. Among repeating records, the actual number of patients processed in the period is 65. Further selection of included patients was made, since some of these patients were non-Chinese or had limited information on the Clinical Management System (CMS). Exclusion criteria were non-Chinese ethnicity, concurrent diagnosis of any non-haematological malignancies, concurrent diagnosis of any non-therapy related haematological malignancies, and incomplete medical records. 41 patients were included in total.

Data collection

Medical records of the included patients were examined to extract relevant data for the study. Both CMS and Laboratory Information System (LIS) were accessed. Demographic data including sex and age at diagnosis were collected. Clinical data such as dates of diagnosis, relapse and death (if applicable), hospital of diagnosis, case status and vital status were also reviewed. Patient presentation, including pattern of lymph node involvement, extranodal site(s) of involvement, bone marrow involvement, peripheral blood involvement, central nervous system (CNS) involvement, Ann Arbor stage and ECOG PS were also included. From the biopsy reports, the pathology of the neoplasm (blastoid/non-blastoid) were noted. SOX11 status and Ki67 percentage were noted, if mentioned in the original report. Serum LDH level at diagnosis was also included. Treatment protocols including induction regimens at diagnosis and relapse were collected as well. Participation at clinical trials was also assessed.

Calculations and statistics

Overall survival (OS) was chosen to present the survival statistics of the study. Due to the lack of clear documentation of the causes of death of some deceased patients, cancer-unrelated deaths could not be ruled out. To calculate survival, the date of diagnosis as stated on the biopsy report and the vital status on 15 October 2019 were used. Overall survival was estimated by Kaplan-Meier method, as provided on the software SPSS Statistics Version 23.

Results

Patient demographics

A total of 41 cases were presented to QMH during the period of 2003-2018. Less than half (48.8%) of the patients were diagnosed at QMH, with the majority being referred cases from other clusters and the private sector. Among the 41 patients, 85.4% were men. The male to female ratio was 5.8:1. The median age at diagnosis was 65 years, with the youngest patient at 46 and the oldest 84. The majority of the patients were elderly, with 53.7% greater than 65 years old.

Patient presentation, clinical and pathological characteristics

The majority of patients presented in late stage. 97% of patients were diagnosed with stage III(21.2%) and IV(75.8%) MCL. Majority of patients presented with lymphadenopathy, with 92.7% having lymph node involvement. Extranodal manifestation was common as 58.5% of patients had a least 1 extranodal organ involvement. Common organs involved were spleen (31.7%), GI tract (24.4%), liver (9.4%), bone (7.3%, n=3) and lung, parotid gland, pancreas and muscle (each 2.4%, n=1). A high incidence of bone marrow involvement (68.3%) was noted. Peripheral blood involvement was less common at 26.8%. Serum LDH was found to be elevated in 57.5% of patients. Blastoid presentation was noted in 4.9% of patients at diagnosis. A further 4.9% had undergone blastoid transformation during the course of their disease.

Treatment

All of the patients were treated by some form of chemotherapy at diagnosis. A total of 15 regimens were prescribed. First-line use of rituximab was noted in 75.6% of patients. 4.9% of patients received obinutuzumab as a part of induction therapy. Bendamustine was given to 24.4% of patients. 43.9% (n=18) of patients had participated in a clinical trial during their disease course. 22.2% (n=4) of patients participated in an ibrutinib trial while 83% (n=15) participated in an arsenic trial. A 5.6% (n=1) participation was noted for a bortezomib trial and an anti-CD40 trial each. Repeated clinical trial participation was noted in 3 patients. 17.1% (n=7) of patients received a bone marrow transplant. 4 received autologous HSCT and the remaining 3 received allogenic HSCT. 7.3% (n=3) of patients were deemed transplant eligible but did not proceed to transplant. Reasons include death before transplant procedure and patient refusal.

Discussion

From our results, it is shown that there are a number of similarities between the epidemiological pattern of MCL in Western and Hong Kong Chinese patients. Elderly patients remained the majority in MCL, as the median age at diagnosis found in our study (65 years) fits the reported range of 65-70 years by Western studies , as well as the sole study on Hong Kong Chinese MCL patients by Chim et al. (65.5 years). A high proportion of elderly patients (53.7%) was also recorded in our study. However, it was significantly lower than that observed in a French study at 71.9% [m1]. More data from different regions is needed to confirm whether our patient constitution is indeed shifted to the younger side.

Male predominance is also confirmed in our study. Our study reported a male to female ratio of 5.8:1, which was significantly higher than that observed in previous Western studies ranging from 2-4 . It also exceeded the 3:1 ratio reported by Chim et al. The high number of males observed in our study may suggest a stronger male predominance in Chinese MCL patients, but the effect of extreme data cannot be ruled out.

Our study also confirmed that MCL patients typically presents in late stage. There was almost exclusive late stage presentation (97%) observed in our study, which was higher than the 80% reported by Chim et al. and the 75-80% in previous Western studies . Extranodal involvement is common, as exemplified by 58.5% patients having at least 1 extranodal site compromised at diagnosis. GI tract remains a common site of involvement, where 24.4% of patients presented with Gi involvement. This is consistent with that observed by Chim et al., who reported 20%. A high percentage of involvement at bone marrow (68.3%) and a considerable peripheral blood involvement (26.8%) were noted for our patients but the relevant statistics were not provided in both the French and Hong Kong studies.

Analysis of therapy regimens has proved to be difficult because of the large number of induction regimens attempted, and changes made to the regimens at mid-course further complicates the assessment of drug efficacy. Interestingly, due to the long timespan the study period covered, temporal changes of the induction regimen could be observed. The inclusion of rituximab in front-line therapy has increased as well. From limited application the late 1990s, rituximab has been incorporated to the standard induction regimen as seen in patients diagnosed in the 2010s. A high proportion of patients (43.9%) was included in a clinical trial, which was significantly higher than the French population’s 12% . This could be explained as QMH is a clinical trial centre. Only a limited percentage (17.1%) of patients received HSCT. A possible explanation could be extensive bone marrow involvement complicates the harvesting of haematopoietic stem cells for autologous transplantation. The high proportion of elderly patients also makes HSCT an unviable option due to age constraints.

Limitations

As our study was not a territory-wide study, only data processed by QMH could be retrieved. Therefore, calculating MCL incidence was not possible as data from other clusters could not be collected. Moreover, as only one centre is assessed, data collection is prone to bias and error. More data from other centres is needed to provide a complete picture of MCL epidemiology in Hong Kong and to confirm the features observed in our study. Given that QMH is the leading tertiary centre in the treatment and research of haematological diseases, confounders may affect the overall patient presentation. For example, patients referred from other secondary hospitals may have a more aggressive disease course to warrant sub-specialist care at QMH. The wide availability of clinical trials in QMH could also influence patient’s therapy options, thus affecting the survival statistics observed.

Abstract

Infectious diseases remain a major cause of human and animal morbidity and mortality leading to significant healthcare expenditure.However, enormous successes have been obtained against the control of major epidemic diseases, such as malaria, plague, leprosy and cholera, in the past.The vast terrains and extreme geo-climatic differences and uneven population distribution present unique patterns of distribution of viral diseases. Dynamic interplay of biological, socio-cultural and ecological factors, together with novel aspects of human-animal interphase, pose additional challenges with respect to the emergence of infectious diseases. The important challenges faced in the control and prevention of emerging and re-emerging infectious diseases range from understanding the impact of factors that are necessary for the emergence, to development of strengthened surveillance systems that can mitigate human suffering and death.Viral pathogens are known to cause outbreaks that have epidemic and pandemic potential which would result in severe range of mortality and Health care expenditure on a scale depending on the pathogenicity of the virus.

Introduction

The emergence of novel human t of emerging infections of humans are zoonotic in origin , with two-third originating in wildlife, including COVID-19.[3] Habitat destruction due to unplanned urbanization has placed human at contact with animals and arthropod vectors of viral infection.[4] Such interactions have been one of the major causes for increased human susceptibility to infections by novel pathogens, in the absence of specific immunity in these population.[5]

Respiratory viral infections, arboviral infections and bat-borne viral infections represent three major categories of emerging viral infections.[6] Infection aerosols of the tracheo bronchial tree represent efficient means for spread of viral pathogens affecting the respiratory tract. Pandemic influenza H1N1, highly pathogenic avian influenza ase.[9] Theme of re-emergence of the virus is often seen in a more virulent forms following their initial discovery.[10] There have also been cases of discal produce and products from affected regions.The major emerging and re-emerging viral infections of public health importance have been reviewed that have already been included in the Integrated Disease Surveillance Programme so that control and prevention of emerging and re-emerging infectious diseases could be handled through understanding the impact of factors that are necessary for the emergence and to develop and strengthen surveillance systems that can mitigate human suffering and death.

Materials and methods

Article collection for this systematic review was collected and analysed from the PMC database, Mediline embrace Cochrane. Necessary articles selected based on this importance to this review article on emerging and re-emerging viral threat. From which 30 articles were reviewed and selected using scholarly search engines of PubMED & Google,Inc.

Emerging Viral infections identified as public health threats

Viral pathogens are known to cause outbreaks that have epidemic and pandemic potential. [13,14]Integrated Disease Surveillance Programme (IDSP) is a laboratory-based, IT enabled system in the country for Surveillance of epidemic prone disease. During 2017, the IDSP showed a total of 1683 outbreaks of such disease of which 71 % of those outbreaks were caused by viral pathogens while the rest 29 % were non-viral. Subclinical and sporadic infection as well as those not identified by the health facility are often missed by the surveillance system.[4,13]

Impact of Mass gatherings and emerging viral infections

Mass gathering opportunities create situations for human proximity within very close distances and the challenges they present to the maintenance of sanitation, a considerable public health concern. Transmission of respiratory and gastrointestinal infection remains a major concern during several large-scale assemblies, for example outbreak of cholera at Kumbh Mela festival in 1817. [15]Large scale gatherings provide platforms for exchange of genomic material and thereby evolution of pathogens, including viruses.[16][17]

Nosocomial Transmission and Emerging infection

Institutional care of vulnerable people with compromised immune systems may present opportunities for transmission of viral infection.[16,18] Appreciable risks also exist at dental clinics, haemodialysis units etc. where sterilization/disinfection practices for patient care instruments are not followed stringently. Hospital-associated transmission of infection was a prominent finding during the outbreak of Nipah infection in Bengal and Kerala, where several health care staff fell victims to the infections.[19]

Laboratory Accidents/Lapses in Biosafety practices

There is a current investigation going on at WHO regarding the outbreak of COVID-19 at Wuhan, China. Several experts believe that the initial outbreak of COVID-19 is from the Wuhan Institute of Virology, a microbiology laboratory under the Chinese Academy Science and investigations are ongoing.[20,21] Neglect of laboratory biosafety requirements as well as laboratory accidents may also lead to the occurrences of emerging/re-emerging infections. Recently there was a report on the development of buffalopox (BPX) lesions on the palm of a biomedical researcher following a shrapnel injury,warranting surgical treatment and leading to delayed healing.[22] Such reports, through infrequent emphasize the need for stringent adherence to biosafety guidelines to be observed in research involving viral agents with human pathogenic potential.[23]

Current Scenario of Emerging Viral Infections

Acute respiratory disease claims over four million deaths every year and causes millions of hospitalization in developing countries every year. Over 200 viral pathogens, belonging to the families Orthomyxoviridae, Paramyxoviridae, Picornaviridae, Coronaviridae, Adenoviridae and Herpesviridae cause respiratory infections in humans. Influenza, parainfluenza, respiratory syncytial virus (RSV) and adenoviruses remain important respiratory pathogens. Human meta pneumovirus has been recognised worldwide as a pathogen of significance.[24]

Respiratory viral infections

COVID-19

Coronavirus disease 2019 (COVID-19) is defined as illness caused by a novel coronavirus now called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2; formerly called 2019-nCoV), which was first identified amid an outbreak of respiratory illness cases in Wuhan City, Hubei Province, China. It was initially reported to the WHO on December 31, 2019. On January 30, 2020, the WHO declared the COVID-19 outbreak a global health emergency. On March 11, 2020, the WHO declared COVID-19 a global pandemic, its first such designation since declaring H1N1 influenza a pandemic in 2009.[25,26]

Illness caused by SARS-CoV-2 was termed COVID-19 by the WHO, the acronym derived from ‘coronavirus disease 2019. ‘ The name was chosen to avoid stigmatizing the virus’s origins in terms of populations, geography, or animal associations[20]

Influenza

Influenza viruses, belonging to the Orthomyxoviridae family, are the frequent causes of epidemics and pandemics affecting humans. Influenza pandemics have occurred earlier in 1918 (Swine influenza), 1957 (Asian flu), 1968 (Hong Kong flu), 1977 (Russian flu) and the recent pandemic of 2009 (pandemic influenza A H1N1). Influenza virus type A is highly variable, shows continuous antigenic variation and is a major cause of epidemics and pandemics. The surface antigenic glycoproteins undergo two major types of antigenic variation, viz. antigenic shift and antigenic drift. Antigenic shift is the result of major changes in one or both the surface antigens [haemagglutinin (HA) and neuraminidase (NA)] and causes occasional pandemics. Three mechanisms might be operative in the antigenic shift, leading to emergence of pandemic influenza strains, viz. genetic reassortment, direct transfer from avian/mammalian host to humans and virus recycling. Antigenic drift results due to minor changes in HA or NA and causes frequent epidemics. Influenza viruses are continuously evolving and show ubiquitous distribution in the environment, animals and humans.[27]

Severe acute respiratory syndrome-associated coronavirus (SARS-CoV)

SARS was first reported in the Guangdong province of China in February 2003 showing human-to-human transmission. The disease caused an estimated 8000 cases and more than 750 deaths in more than 12 countries]. The WHO issued a global alert about the disease on March 13, 2003. Although the cases mostly remained confined to China, a few cases were reported from North and South America, Europe and Asia. No case, however, has been reported fromIndia.[28]

MERS-CoV

MERS-CoV is a zoonotic viral illness causing respiratory infection which was first reported in Saudi Arabia in 2012 and has since spread to 26 different countries. Over 2207 laboratory-confirmed cases and 787 deaths have occurred due to MERS-CoV infection globally, since 2012. The clinical spectrum of illness associated with MERS-CoV ranges from asymptomatic infections to acute respiratory distress syndrome, resulting in multi-organ failure and death. The case-fatality rates (CFRs) have remained high at 3-4 per 10 cases. [29]Limited information currently exists about the transmission dynamics of this virus, and definitive treatment and a prophylactic vaccination remain unavailable till date. Evidence for secondary, tertiary and quaternary cases of MERS ensuing from a single infected patient also exists, even in the absence of mutations conferring hyper-virulence. No case of infection with this virus has been detected in India so far. Bats are thought to be the natural reservoirs of this virus, and many patients developed the illness after contact with camels. India is home to a great diversity of bat species and has a substantial camel population. The country also reports heavy passenger traffic from the Middle East, as part of pilgrimage, employment, tourism and trade. These facts call for preparedness and surveillance against this virus in the country.[30]

Avian influenza (AI)

Humans are susceptible to infection with AI and swine influenza viruses, including the AI virus subtypes – A(H5N1), A(H7N9) and A(H9N2). Exposure to infected birds or contaminated environments is thought to underlie human infection with these viruses. Human cases of AI might occur in future, in view of the ongoing circulation of AI viruses in birds. There have been sporadic reports of human infections with AI and other zoonotic influenza viruses, but sustained human-to-human infection and transmission have been lacking. Although the public health risk from the currently known influenza viruses at the human-animal interface remains the same, the sustained human-to-human transmission of this virus is low.[31]

RSV

RSV is an important pathogen causing acute lower respiratory tract infection (ALRTI) in young children. It can also affect older adults and immunocompromised individuals. Estimates indicate an annual incidence of approximately 34 million episodes of ALRTI associated with RSV infection in children aged five years or less.[25] RSV infections also lead to about three million cases of hospitalization and about 66,000-199,000 deaths, with more than 99 per cent of the deaths reported from developing country. In view of the public health significance, the WHO has started a pilot project for RSV surveillance in its six regions, utilizing the well-established platform of Global Influenza Surveillance and Response Network. The exact burden and impact of RSV infections in the country need to be studied in depth.[31,32]

Conclusion

The earth of extreme geo-climatic diversity, faces a constant threat of emerging and re- emerging viral pathogens of public health importance. There is a need for strengthening disease surveillance in the world focusing on the epidemiology and disease burden. There is also a pressing need to gain detailed insight into disease biomics, including vector biology and environmental factors influencing the diseases. It is also important to strengthen the emergency preparedness for these diseases and response by focusing on ‘one health‘ approach.

Reference

1. Dikid T, Jain SK, Sharma A, Kumar A, Narain JP. Emerging & re-emerging infections in India: an overview. Indian J Med Res. 2013;138: 19–31.
2. Ashwin KS, Muralidharan NP. Vancomycin-resistant enterococcus (VRE) vs Methicillin-resistant Staphylococcus Aureus (MRSA). Indian Journal of Medical Microbiology. 2015. p. 166. doi:10.4103/0255-0857.150976
3. Mani RS, Ravi V, Desai A, Madhusudana SN. Emerging Viral Infections in India. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences. 2012. pp. 5–21. doi:10.1007/s40011-011-0001-1
4. Girija ASS, Smiline Girija AS, Vijayashree Priyadharsini J, Paramasivam A. Plasmid-encoded resistance to trimethoprim/sulfamethoxazole mediated by dfrA1, dfrA5, sul1 and sul2 among Acinetobacter baumannii isolated from urine samples of patients with severe urinary tract infection. Journal of Global Antimicrobial Resistance. 2019. pp. 145–146. doi:10.1016/j.jgar.2019.04.001
5. Heymann DL. Emerging and Re-Emerging Infectious Diseases in Our Global Village. Issues in Infectious Diseases. 2006. pp. 112–124. doi:10.1159/000096694
6. Tran TH, Nguyen TL, Nguyen TD, Luong TS, Pham PM, Nguyen van VC, et al. Avian influenza A (H5N1) in 10 patients in Vietnam. N Engl J Med. 2004;350: 1179–1188.
7. Selvakumar R, Np M. COMPARISON IN BENEFITS OF HERBAL MOUTHWASHES WITH CHLORHEXIDINE MOUTHWASH: A REVIEW. Asian Journal of Pharmaceutical and Clinical Research. 2017. p. 3. doi:10.22159/ajpcr.2017.v10i2.13304
8. Shahana RY, Muralidharan NP. Efficacy of mouth rinse in maintaining oral health of patients attending orthodontic clinics. Research Journal of Pharmacy and Technology. 2016. p. 1991. doi:10.5958/0974-360x.2016.00406.6
9. Marickar RF, Geetha RV, Neelakantan P. Efficacy of Contemporary and Novel Intracanal Medicaments againstEnterococcus Faecalis. Journal of Clinical Pediatric Dentistry. 2014. pp. 47–50. doi:10.17796/jcpd.39.1.wmw9768314h56666
10. Gopalakrishnan R, Sureshkumar D, Thirunarayan MA, Ramasubramanian V. Melioidosis :an emerging infection in India. J Assoc Physicians India. 2013;61: 612–614.
11. Pratha AA, Ashwatha Pratha A, Geetha RV. Awareness on Hepatitis-B vaccination among dental students-A Questionnaire Survey. Research Journal of Pharmacy and Technology. 2017. p. 1360. doi:10.5958/0974-360x.2017.00240.2
12. Vaishali M, Geetha RV. Antibacterial activity of Orange peel oil on Streptococcus mutans and Enterococcus-An In-vitro study. Research Journal of Pharmacy and Technology. 2018. p. 513. doi:10.5958/0974-360x.2018.00094.x
13. M MA, Geetha RV, Thangavelu L. Evaluation oEvaluation of anti-inflammatory action of Laurus nobilis-an in vitro study,International Journal of Research in Pharmaceutical Sciences. 2019. pp. 1209–1213. doi:10.26452/ijrps.v10i2.408
14. Gale RP. Conquest of COVID-19. Publish it to Death? Br J Haematol. 2020. doi:10.1111/bjh.16905
15. Higgs S, Vanlandingham DL, Powers A. Chikungunya and Zika Viruses: Global Emerging Health Threats. Academic Press; 2018.
16. Girija SA, Jayaseelan VP, Arumugam P. Prevalence of VIM- and GIM-producing Acinetobacter baumannii from patients with severe urinary tract infection. Acta Microbiol Immunol Hung. 2018;65: 539–550.
17. Kastritis E, Wechalekar A, Schönland S, Sanchorawala V, Merlini G, Palladini G, et al. Challenges in the Management of patients with systemic light chain (AL) amyloidosis during the COVID-19 pandemic. Br J Haematol. 2020. doi:10.1111/bjh.16898
18. Smiline ASG, Vijayashree JP, Paramasivam A. Molecular characterization of plasmid-encoded blaTEM, blaSHV and blaCTX-M among extended spectrum β-lactamases [ESBLs] producing Acinetobacter baumannii. British Journal of Biomedical Science. 2018. pp. 200–202. doi:10.1080/09674845.2018.1492207
19. Paramasivam A, Vijayashree Priyadharsini J, Raghunandhakumar S. N6-adenosine methylation (m6A): a promising new molecular target in hypertension and cardiovascular diseases. Hypertens Res. 2020;43: 153–154.
20. Kumar P, Sharma J. Extubation is as important as intubation in COVID 19. J Clin Anesth. 2020;66: 109934.
21. Meena RP. Covid – 19: Coronavirus Perfect weapon or just coincidence. New Era Publication;
22. Priyadharsini JV, Vijayashree Priyadharsini J, Smiline Girija AS, Paramasivam A. An insight into the emergence of Acinetobacter baumannii as an oro-dental pathogen and its drug resistance gene profile – An in silico approach. Heliyon. 2018. p. e01051. doi:10.1016/j.heliyon.2018.e01051
23. Priyadharsini JV, Vijayashree Priyadharsini J, Smiline Girija AS, Paramasivam A. In silico analysis of virulence genes in an emerging dental pathogen A. baumannii and related species. Archives of Oral Biology. 2018. pp. 93–98. doi:10.1016/j.archoralbio.2018.07.001
24. Ennaji MM. Emerging and Reemerging Viral Pathogens: Volume 2: Applied Virology Approaches Related to Human, Animal and Environmental Pathogens. Academic Press; 2019.
25. Cecilia D. Current status of dengue and chikungunya in India. WHO South-East Asia Journal of Public Health. 2014. p. 22. doi:10.4103/2224-3151.206879
26. Balasubramanian DM. Covid 19 – The New Age Pandemic. Notion Press; 2020.
27. Halstead SB. Nosocomial dengue in health-care workers – Author’s reply. The Lancet. 2008. p. 299. doi:10.1016/s0140-6736(08)60159-2
28. Paixão ES, Teixeira MG, Rodrigues LC. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Glob Health. 2018;3: e000530.
29. Mourya D, Gokhale M, Majumdar T, Yadav P, Kumar V, Mavale M. Experimental Zika virus infection in Aedes aegypti: Susceptibility, transmission & co-infection with dengue & chikungunya viruses. Indian Journal of Medical Research. 2018. p. 88. doi:10.4103/ijmr.ijmr_1142_17
30. Bhatt PN, Rodrigues FM. Chandipura: a new Arbovirus isolated in India from patients with febrile illness. Indian J Med Res. 1967;55: 1295–1305.
31. Casals J. Antigenic similarity between the virus causing Crimean hemorrhagic fever and Congo virus. Proc Soc Exp Biol Med. 1969;131: 233–236.
32. Nichter M. Kyasanur Forest Disease: An Ethnography of a Disease of Development. Medical Anthropology Quarterly. 1987. pp. 406–423. doi:10.1525/maq.1987.1.4.02a00040

In his brilliant and award-winning, yet slightly disturbing and controversial novel “Stuck in Neutral”, Terry Trueman narrates the fictional story of Shawn McDaniel, a fourteen-year-old boy with Cerebral Palsy. Shawn, self-portrayed as happy and more intelligent than most, is robbed of his ability to control his muscles, suffers from frequent seizures, and is viewed by others as retarded. This leaves him feeling trapped in his own body, and completely dependent on caregivers, mostly his mother, for his activities of daily living. What’s more? Shawn believes his father, out of love, intends to murder him to end his supposed suffering.

Trueman’s depiction of cerebral palsy, though fictional and perhaps slightly distorted, paints a very vivid picture of the devastating nature of this disorder both for patients and relatives/caregivers of children with cerebral palsy. Sadly, despite the neuroscience community’s giant strides in recent years, currently available treatments for cerebral palsy remain largely supportive and directed at rehabilitation with very limited efficacy. Recent attempts at developing more novel and effective therapies targeting cerebral injury have focused on the use of stem cells, special human cells that can develop into many different cell types. These stem cells, present in different locations in the body including the bone marrow, umbilical cord etc., also have regenerative and anti-inflammatory properties making them very attractive strategies for developing a possible cure for cerebral palsy.

Studies using this stem cell approach have reported improvements in gross motor function and alleviation of brain lesions in animal models. However, there have been relatively fewer clinical research involving humans, leaving a bench-to-bedside gap that needs bridging.

In a recent research, Jiaowei Gu and her colleagues in China conducted a randomized trial to determine the safety and efficacy of stem cells derived from the human umbilical cord with concomitant rehabilitation in the treatment of cerebral palsy. The team recruited 40 children with cerebral palsy aged 2-12 years and randomly assigned them, in a double blinded manner, to one of two groups: a test (umbilical cord-derived stem cell transplant) group and a control (placebo) group.

Participants in the test group received a total of 4 doses of stem cell transplantation via intravenous administration, each dose 7days apart, while the control group received an equal number of doses of Albumin in Normal Saline infusion as placebo. Both groups of patients were placed on a form of physical rehabilitation called Bobath therapy. At scheduled follow-up visits 1, 3 , 6, & 12 months after the last dose of respective interventions, the participants were monitored for possible adverse reactions to the interventions as well as for improvements across 3 domains of functioning: Gross Motor Function, Comprehensive Function, Activities of Daily living using respective instruments/scales.

The researchers found the stem cell transplant to be safe, with only mild-moderate adverse reactions reported. They also observed that participants who received the stem cell transplant in combination with physical rehabilitation showed significantly greater improvements across all 3 domains of functioning assessed (Figure 1). These improvements were observed even in the older subjects, providing evidence that the therapeutic window of the transplant extends to years after the brain injury. Other interesting findings reported include a reduction in inflammatory mediators and an increase in cerebral metabolic activity, as seen on a PET/CT scan, in a subset of patients who received the transplant compared to the placebo group, offering some insight into the possible mechanisms underlying the observed effects.

The findings from this very insightful research provide a much-needed beacon of hope for children like the fictional Shawn McDaniel living with cerebral palsy. With more extensive and large scale translational research built on these insights, perhaps cerebral palsy research in the near or distant future can find a cure for the disorder or at the very least, significantly improve the quality of life of affected individuals.